Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0422 Transporter Info
Gene Name SLC5A2
Transporter Name Sodium/glucose cotransporter 2
Gene ID
6524
UniProt ID
P31639
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A2 in hepatocellular carcinoma [ 1 ]

Location

 TSS1500 (cg22333846)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.59E+00 Statistic Test p-value: 4.69E-15; Z-score: 6.72E+00

Methylation in Case

 3.10E-01 (Median) Methylation in Control 1.20E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A2 in hepatocellular carcinoma [ 1 ]

Location

 TSS1500 (cg22883889)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.40E+00 Statistic Test p-value: 2.54E-10; Z-score: -1.57E+00

Methylation in Case

 2.49E-01 (Median) Methylation in Control 3.49E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A2 in hepatocellular carcinoma [ 1 ]

Location

 1stExon (cg13473336)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.37E-06; Z-score: -1.34E+00

Methylation in Case

 7.11E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC5A2 in hepatocellular carcinoma [ 1 ]

Location

 1stExon (cg01406145)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.36E-02; Z-score: -2.71E-01

Methylation in Case

 7.38E-01 (Median) Methylation in Control 7.44E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC5A2 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg00016841)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.57E+00 Statistic Test p-value: 1.22E-07; Z-score: 8.12E-01

Methylation in Case

 1.39E-01 (Median) Methylation in Control 8.86E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC5A2 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg02242894)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 4.03E-05; Z-score: -8.56E-01

Methylation in Case

 8.27E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A2 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS1500 (cg02109766)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.01E-02; Z-score: 8.09E-01

Methylation in Case

 4.05E-02 (Median) Methylation in Control 3.60E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A2 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS200 (cg03181582)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.62E+00 Statistic Test p-value: 7.72E-11; Z-score: 1.95E+00

Methylation in Case

 3.12E-01 (Median) Methylation in Control 1.93E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A2 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg11231434)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.30E+00 Statistic Test p-value: 1.21E-34; Z-score: -5.32E+00

Methylation in Case

 6.59E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC5A2 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg17771569)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 4.28E-05; Z-score: -1.01E+00

Methylation in Case

 2.58E-01 (Median) Methylation in Control 3.26E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC5A2 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg15316949)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 4.86E-03; Z-score: -4.26E-01

Methylation in Case

 8.62E-02 (Median) Methylation in Control 9.36E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Breast cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A2 in breast cancer [ 3 ]

Location

 TSS200 (cg01171858)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.67E-02; Z-score: -6.59E-01

Methylation in Case

 8.28E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A2 in breast cancer [ 3 ]

Location

 1stExon (cg01406145)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 7.12E-08; Z-score: -1.82E+00

Methylation in Case

 7.14E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A2 in breast cancer [ 3 ]

Location

 1stExon (cg13473336)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 3.56E-06; Z-score: -1.18E+00

Methylation in Case

 7.28E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC5A2 in breast cancer [ 3 ]

Location

 Body (cg18892212)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.36E+00 Statistic Test p-value: 6.27E-12; Z-score: 2.53E+00

Methylation in Case

 4.37E-01 (Median) Methylation in Control 3.22E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC5A2 in breast cancer [ 3 ]

Location

 Body (cg02242894)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 8.02E-04; Z-score: -5.54E-01

Methylation in Case

 8.42E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC5A2 in breast cancer [ 3 ]

Location

 Body (cg00016841)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 2.66E-02; Z-score: -7.58E-01

Methylation in Case

 8.01E-02 (Median) Methylation in Control 9.49E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A2 in colorectal cancer [ 4 ]

Location

 TSS200 (cg01171858)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 4.80E-02; Z-score: 4.92E-01

Methylation in Case

 9.37E-01 (Median) Methylation in Control 9.31E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A2 in colorectal cancer [ 4 ]

Location

 Body (cg00016841)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 3.61E-04; Z-score: 5.53E-01

Methylation in Case

 1.11E-01 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A2 in colorectal cancer [ 4 ]

Location

 Body (cg18892212)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 2.14E-02; Z-score: 4.59E-01

Methylation in Case

 8.25E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A2 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 1stExon (cg01406145)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.53E+00 Statistic Test p-value: 3.68E-28; Z-score: -4.20E+00

Methylation in Case

 5.65E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A2 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 1stExon (cg13473336)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.40E+00 Statistic Test p-value: 2.28E-19; Z-score: -3.23E+00

Methylation in Case

 6.28E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A2 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 Body (cg00016841)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 1.42E-05; Z-score: 1.17E+00

Methylation in Case

 8.23E-01 (Median) Methylation in Control 6.61E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC5A2 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 Body (cg00029825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.85E+00 Statistic Test p-value: 1.45E-05; Z-score: -1.56E+00

Methylation in Case

 1.05E-01 (Median) Methylation in Control 4.05E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC5A2 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 Body (cg02242894)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.30E-04; Z-score: 8.15E-01

Methylation in Case

 8.53E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC5A2 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 Body (cg02262187)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.71E+00 Statistic Test p-value: 1.38E-04; Z-score: -6.50E-01

Methylation in Case

 8.46E-02 (Median) Methylation in Control 1.45E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC5A2 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 Body (cg06888094)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 3.03E-03; Z-score: 6.44E-01

Methylation in Case

 8.75E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A2 in bladder cancer [ 6 ]

Location

 1stExon (cg13473336)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 3.40E-06; Z-score: -5.09E+00

Methylation in Case

 5.55E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A2 in bladder cancer [ 6 ]

Location

 1stExon (cg01406145)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.02E-02; Z-score: -1.07E+00

Methylation in Case

 6.65E-01 (Median) Methylation in Control 6.84E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A2 in bladder cancer [ 6 ]

Location

 Body (cg18892212)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.67E+00 Statistic Test p-value: 3.42E-07; Z-score: 6.13E+00

Methylation in Case

 4.79E-01 (Median) Methylation in Control 2.87E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC5A2 in bladder cancer [ 6 ]

Location

 Body (cg02242894)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 5.74E-04; Z-score: -4.37E+00

Methylation in Case

 7.72E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC5A2 in bladder cancer [ 6 ]

Location

 Body (cg00029825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 2.01E-03; Z-score: 1.74E+01

Methylation in Case

 7.04E-01 (Median) Methylation in Control 5.30E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC5A2 in bladder cancer [ 6 ]

Location

 Body (cg06888094)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.36E+00 Statistic Test p-value: 8.76E-03; Z-score: -2.30E+00

Methylation in Case

 1.71E-01 (Median) Methylation in Control 2.33E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  HIV infection

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A2 in HIV infection [ 7 ]

Location

 1stExon (cg13473336)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.59E-06; Z-score: 1.05E+00

Methylation in Case

 7.59E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A2 in HIV infection [ 7 ]

Location

 1stExon (cg01406145)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 4.84E-04; Z-score: 1.07E+00

Methylation in Case

 7.19E-01 (Median) Methylation in Control 6.86E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A2 in HIV infection [ 7 ]

Location

 Body (cg06888094)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.54E+00 Statistic Test p-value: 1.67E-07; Z-score: 1.96E+00

Methylation in Case

 1.76E-01 (Median) Methylation in Control 1.15E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC5A2 in HIV infection [ 7 ]

Location

 Body (cg02262187)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.59E+00 Statistic Test p-value: 3.13E-06; Z-score: 2.69E+00

Methylation in Case

 1.42E-01 (Median) Methylation in Control 8.90E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC5A2 in HIV infection [ 7 ]

Location

 Body (cg00029825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 4.91E-03; Z-score: 5.66E-01

Methylation in Case

 9.24E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC5A2 in HIV infection [ 7 ]

Location

 Body (cg18892212)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 9.97E-03; Z-score: 7.30E-01

Methylation in Case

 5.63E-01 (Median) Methylation in Control 5.26E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC5A2 in HIV infection [ 7 ]

Location

 Body (cg02242894)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.79E-02; Z-score: -2.53E-01

Methylation in Case

 9.01E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A2 in systemic lupus erythematosus [ 8 ]

Location

 1stExon (cg13473336)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.39E-02; Z-score: -1.63E-01

Methylation in Case

 8.30E-01 (Median) Methylation in Control 8.37E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A2 in systemic lupus erythematosus [ 8 ]

Location

 Body (cg00016841)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.51E-02; Z-score: -1.95E-01

Methylation in Case

 1.02E-01 (Median) Methylation in Control 1.06E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A2 in clear cell renal cell carcinoma [ 9 ]

Location

 Body (cg06888094)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 5.81E-03; Z-score: -1.07E+00

Methylation in Case

 2.68E-01 (Median) Methylation in Control 3.37E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A2 in clear cell renal cell carcinoma [ 9 ]

Location

 Body (cg18892212)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 4.01E-02; Z-score: 7.89E-01

Methylation in Case

 4.40E-01 (Median) Methylation in Control 3.89E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A2 in colon adenocarcinoma [ 10 ]

Location

 Body (cg00378292)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 9.35E-04; Z-score: -1.14E+00

Methylation in Case

 3.07E-01 (Median) Methylation in Control 3.59E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A2 in lung adenocarcinoma [ 11 ]

Location

 Body (cg18892212)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.34E+00 Statistic Test p-value: 1.07E-02; Z-score: 1.64E+00

Methylation in Case

 6.03E-01 (Median) Methylation in Control 4.49E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A2 in lung adenocarcinoma [ 11 ]

Location

 Body (cg00029825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 4.10E-02; Z-score: 1.31E+00

Methylation in Case

 8.44E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A2 in papillary thyroid cancer [ 12 ]

Location

 Body (cg00029825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 1.34E-07; Z-score: 1.54E+00

Methylation in Case

 6.84E-01 (Median) Methylation in Control 5.87E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A2 in papillary thyroid cancer [ 12 ]

Location

 Body (cg02262187)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 1.85E-02; Z-score: -1.23E+00

Methylation in Case

 2.31E-01 (Median) Methylation in Control 2.83E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A2 in prostate cancer [ 13 ]

Location

 Body (cg25117841)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.67E+00 Statistic Test p-value: 4.73E-04; Z-score: 6.24E+00

Methylation in Case

 8.58E-01 (Median) Methylation in Control 5.15E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A2 in prostate cancer [ 13 ]

Location

 Body (cg04186249)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 1.67E-02; Z-score: -1.13E+01

Methylation in Case

 6.70E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-3155a directly targets SLC5A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3155a miRNA Mature ID miR-3155a

miRNA Sequence

 CCAGGCUCUGCAGUGGGAACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-3155b directly targets SLC5A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3155b miRNA Mature ID miR-3155b

miRNA Sequence

 CCAGGCUCUGCAGUGGGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-3663 directly targets SLC5A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3663 miRNA Mature ID miR-3663-3p

miRNA Sequence

 UGAGCACCACACAGGCCGGGCGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-4268 directly targets SLC5A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4268 miRNA Mature ID miR-4268

miRNA Sequence

 GGCUCCUCCUCUCAGGAUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-4286 directly targets SLC5A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4286 miRNA Mature ID miR-4286

miRNA Sequence

 ACCCCACUCCUGGUACC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-484 directly targets SLC5A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-484 miRNA Mature ID miR-484

miRNA Sequence

 UCAGGCUCAGUCCCCUCCCGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-6784 directly targets SLC5A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6784 miRNA Mature ID miR-6784-3p

miRNA Sequence

 UCUCACCCCAACUCUGCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-6802 directly targets SLC5A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6802 miRNA Mature ID miR-6802-3p

miRNA Sequence

 UUCACCCCUCUCACCUAAGCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-6862 directly targets SLC5A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6862 miRNA Mature ID miR-6862-3p

miRNA Sequence

 CCUCACCCAGCUCUCUGGCCCUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-6886 directly targets SLC5A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6886 miRNA Mature ID miR-6886-5p

miRNA Sequence

 CCCGCAGGUGAGAUGAGGGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
6 DNA Methylation Dynamics in Urological Tumors.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
9 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
10 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
11 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.