Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0424 Transporter Info
Gene Name SLC5A4
Transporter Name Sodium/glucose cotransporter 3
Gene ID
6527
UniProt ID
Q9NY91
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A4 in bladder cancer [ 1 ]

Location

 TSS1500 (cg01337931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.45E+00 Statistic Test p-value: 1.16E-07; Z-score: -8.71E+00

Methylation in Case

 5.40E-01 (Median) Methylation in Control 7.84E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A4 in bladder cancer [ 1 ]

Location

 TSS1500 (cg09244200)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.54E+00 Statistic Test p-value: 1.00E-05; Z-score: -5.41E+00

Methylation in Case

 4.38E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A4 in bladder cancer [ 1 ]

Location

 TSS1500 (cg22027471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.55E+00 Statistic Test p-value: 5.80E-05; Z-score: -6.79E+00

Methylation in Case

 4.86E-01 (Median) Methylation in Control 7.51E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC5A4 in bladder cancer [ 1 ]

Location

 TSS200 (cg21578906)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.62E+00 Statistic Test p-value: 1.55E-11; Z-score: -9.99E+00

Methylation in Case

 4.92E-01 (Median) Methylation in Control 7.98E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC5A4 in bladder cancer [ 1 ]

Location

 1stExon (cg19643467)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 5.46E-05; Z-score: -9.98E+00

Methylation in Case

 6.64E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC5A4 in bladder cancer [ 1 ]

Location

 Body (cg13507893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.01E-02; Z-score: -1.27E+00

Methylation in Case

 8.79E-01 (Median) Methylation in Control 8.89E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A4 in breast cancer [ 2 ]

Location

 TSS1500 (cg22027471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.46E+00 Statistic Test p-value: 2.89E-11; Z-score: -2.19E+00

Methylation in Case

 4.91E-01 (Median) Methylation in Control 7.14E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A4 in breast cancer [ 2 ]

Location

 TSS1500 (cg09244200)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 2.43E-05; Z-score: -1.38E+00

Methylation in Case

 5.06E-01 (Median) Methylation in Control 6.08E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A4 in breast cancer [ 2 ]

Location

 TSS1500 (cg01337931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.64E-03; Z-score: -1.08E+00

Methylation in Case

 6.46E-01 (Median) Methylation in Control 6.97E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC5A4 in breast cancer [ 2 ]

Location

 TSS200 (cg21578906)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 6.91E-09; Z-score: -2.92E+00

Methylation in Case

 6.85E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC5A4 in breast cancer [ 2 ]

Location

 1stExon (cg19643467)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 3.34E-05; Z-score: -1.45E+00

Methylation in Case

 6.73E-01 (Median) Methylation in Control 7.56E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC5A4 in breast cancer [ 2 ]

Location

 Body (cg13507893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.08E-03; Z-score: -2.67E-01

Methylation in Case

 8.54E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A4 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg01337931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 5.35E-08; Z-score: -2.95E+00

Methylation in Case

 7.93E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A4 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg22027471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 2.97E-07; Z-score: -1.58E+00

Methylation in Case

 6.56E-01 (Median) Methylation in Control 7.88E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A4 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg09244200)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 4.00E-05; Z-score: -1.18E+00

Methylation in Case

 7.66E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC5A4 in colorectal cancer [ 3 ]

Location

 1stExon (cg19643467)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 9.42E-07; Z-score: -1.61E+00

Methylation in Case

 8.45E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC5A4 in colorectal cancer [ 3 ]

Location

 Body (cg13507893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.01E-03; Z-score: -5.33E-01

Methylation in Case

 8.88E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A4 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg01337931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 9.01E-09; Z-score: -2.58E+00

Methylation in Case

 6.47E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A4 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg09244200)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 4.56E-05; Z-score: -9.66E-01

Methylation in Case

 5.63E-01 (Median) Methylation in Control 6.70E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A4 in hepatocellular carcinoma [ 4 ]

Location

 1stExon (cg19643467)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.63E-02; Z-score: -1.48E-01

Methylation in Case

 7.65E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC5A4 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg27650699)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.81E+00 Statistic Test p-value: 2.86E-19; Z-score: -8.53E+00

Methylation in Case

 4.80E-01 (Median) Methylation in Control 8.70E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC5A4 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg13507893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.79E-07; Z-score: -1.22E+00

Methylation in Case

 8.36E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A4 in HIV infection [ 5 ]

Location

 TSS1500 (cg22027471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.46E+00 Statistic Test p-value: 5.67E-07; Z-score: -1.67E+00

Methylation in Case

 3.08E-01 (Median) Methylation in Control 4.49E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A4 in HIV infection [ 5 ]

Location

 TSS1500 (cg01337931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.92E-04; Z-score: -1.06E+00

Methylation in Case

 7.84E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A4 in HIV infection [ 5 ]

Location

 1stExon (cg19643467)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 2.81E-04; Z-score: -1.64E+00

Methylation in Case

 7.85E-01 (Median) Methylation in Control 8.37E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A4 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg09244200)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 1.05E-05; Z-score: -3.59E+00

Methylation in Case

 6.38E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A4 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg22027471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 1.55E-04; Z-score: -2.89E+00

Methylation in Case

 5.53E-01 (Median) Methylation in Control 7.27E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A4 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg01337931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 2.94E-03; Z-score: -3.28E+00

Methylation in Case

 7.49E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC5A4 in lung adenocarcinoma [ 6 ]

Location

 1stExon (cg19643467)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 6.08E-06; Z-score: -3.98E+00

Methylation in Case

 7.35E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A4 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS1500 (cg18506018)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.34E-04; Z-score: -8.06E-01

Methylation in Case

 6.84E-01 (Median) Methylation in Control 7.33E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A4 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS1500 (cg11161440)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 2.09E-04; Z-score: 8.74E-01

Methylation in Case

 9.09E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A4 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS200 (cg13286281)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 2.55E-02; Z-score: -7.43E-01

Methylation in Case

 1.12E-01 (Median) Methylation in Control 1.42E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC5A4 in pancretic ductal adenocarcinoma [ 7 ]

Location

 1stExon (cg05638493)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 6.40E-08; Z-score: 1.69E+00

Methylation in Case

 5.51E-01 (Median) Methylation in Control 4.15E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC5A4 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg17130789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.95E-08; Z-score: -1.15E+00

Methylation in Case

 7.70E-01 (Median) Methylation in Control 7.96E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC5A4 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg11034122)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.58E-02; Z-score: 6.40E-01

Methylation in Case

 5.81E-01 (Median) Methylation in Control 5.44E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC5A4 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg06064098)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.12E-02; Z-score: -1.81E-01

Methylation in Case

 7.38E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A4 in papillary thyroid cancer [ 8 ]

Location

 TSS1500 (cg01337931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.87E-07; Z-score: -2.04E+00

Methylation in Case

 8.02E-01 (Median) Methylation in Control 8.68E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A4 in papillary thyroid cancer [ 8 ]

Location

 TSS1500 (cg22027471)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 7.39E-05; Z-score: -7.87E-01

Methylation in Case

 7.80E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC5A4 in papillary thyroid cancer [ 8 ]

Location

 TSS200 (cg21578906)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.73E-06; Z-score: -1.42E+00

Methylation in Case

 8.92E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC5A4 in papillary thyroid cancer [ 8 ]

Location

 1stExon (cg19643467)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.08E-07; Z-score: -1.41E+00

Methylation in Case

 8.49E-01 (Median) Methylation in Control 8.98E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A4 in systemic lupus erythematosus [ 9 ]

Location

 TSS1500 (cg01337931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.63E-02; Z-score: -2.72E-01

Methylation in Case

 8.14E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A4 in panic disorder [ 10 ]

Location

 TSS200 (cg21578906)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 4.11E-02; Z-score: 1.67E-01

Methylation in Case

 3.17E+00 (Median) Methylation in Control 3.10E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A4 in panic disorder [ 10 ]

Location

 1stExon (cg19643467)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 3.39E-02; Z-score: 3.22E-01

Methylation in Case

 2.48E+00 (Median) Methylation in Control 2.33E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A4 in prostate cancer [ 11 ]

Location

 TSS200 (cg18883951)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 1.99E-02; Z-score: 2.52E+00

Methylation in Case

 8.93E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A4 in prostate cancer [ 11 ]

Location

 3'UTR (cg10481065)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.98E+00 Statistic Test p-value: 3.84E-02; Z-score: 8.48E+00

Methylation in Case

 4.19E-01 (Median) Methylation in Control 1.41E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC5A4 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 1stExon (cg19643467)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 1.19E-17; Z-score: -2.87E+00

Methylation in Case

 5.30E-01 (Median) Methylation in Control 6.63E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC5A4 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 Body (cg13507893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 3.67E-02; Z-score: 4.81E-01

Methylation in Case

 9.07E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-335 directly targets SLC5A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.