Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0426 Transporter Info | ||||
Gene Name | SLC5A6 | ||||
Transporter Name | Sodium-dependent multivitamin transporter | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
43 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
let-7a directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7a | miRNA Mature ID | let-7a-5p | ||
miRNA Sequence |
UGAGGUAGUAGGUUGUAUAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 2 |
let-7b directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7b | miRNA Mature ID | let-7b-5p | ||
miRNA Sequence |
UGAGGUAGUAGGUUGUGUGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 3 |
let-7c directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7c | miRNA Mature ID | let-7c-5p | ||
miRNA Sequence |
UGAGGUAGUAGGUUGUAUGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 4 |
let-7d directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7d | miRNA Mature ID | let-7d-5p | ||
miRNA Sequence |
AGAGGUAGUAGGUUGCAUAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 5 |
let-7e directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7e | miRNA Mature ID | let-7e-5p | ||
miRNA Sequence |
UGAGGUAGGAGGUUGUAUAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 6 |
let-7f directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7f | miRNA Mature ID | let-7f-5p | ||
miRNA Sequence |
UGAGGUAGUAGAUUGUAUAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 7 |
let-7g directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7g | miRNA Mature ID | let-7g-5p | ||
miRNA Sequence |
UGAGGUAGUAGUUUGUACAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 8 |
let-7i directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7i | miRNA Mature ID | let-7i-5p | ||
miRNA Sequence |
UGAGGUAGUAGUUUGUGCUGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 9 |
miR-1252 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1252 | miRNA Mature ID | miR-1252-3p | ||
miRNA Sequence |
CAAAUGAGCUUAAUUUCCUUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 10 |
miR-1294 directly targets SLC5A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1294 | miRNA Mature ID | miR-1294 | ||
miRNA Sequence |
UGUGAGGUUGGCAUUGUUGUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-139 directly targets SLC5A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-139 | miRNA Mature ID | miR-139-3p | ||
miRNA Sequence |
UGGAGACGCGGCCCUGUUGGAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 12 |
miR-24 directly targets SLC5A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-24 | miRNA Mature ID | miR-24-3p | ||
miRNA Sequence |
UGGCUCAGUUCAGCAGGAACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-27b directly targets SLC5A6 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-27b | miRNA Mature ID | miR-27b-3p | ||
miRNA Sequence |
UUCACAGUGGCUAAGUUCUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 14 |
miR-3138 directly targets SLC5A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3138 | miRNA Mature ID | miR-3138 | ||
miRNA Sequence |
UGUGGACAGUGAGGUAGAGGGAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 15 |
miR-3148 directly targets SLC5A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3148 | miRNA Mature ID | miR-3148 | ||
miRNA Sequence |
UGGAAAAAACUGGUGUGUGCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 16 |
miR-3184 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3184 | miRNA Mature ID | miR-3184-5p | ||
miRNA Sequence |
UGAGGGGCCUCAGACCGAGCUUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 17 |
miR-3529 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3529 | miRNA Mature ID | miR-3529-5p | ||
miRNA Sequence |
AGGUAGACUGGGAUUUGUUGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 18 |
miR-3662 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3662 | miRNA Mature ID | miR-3662 | ||
miRNA Sequence |
GAAAAUGAUGAGUAGUGACUGAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 19 |
miR-3689d directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3689d | miRNA Mature ID | miR-3689d | ||
miRNA Sequence |
GGGAGGUGUGAUCUCACACUCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 20 |
miR-379 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-379 | miRNA Mature ID | miR-379-5p | ||
miRNA Sequence |
UGGUAGACUAUGGAACGUAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 21 |
miR-3927 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3927 | miRNA Mature ID | miR-3927-3p | ||
miRNA Sequence |
CAGGUAGAUAUUUGAUAGGCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 22 |
miR-423 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-423 | miRNA Mature ID | miR-423-5p | ||
miRNA Sequence |
UGAGGGGCAGAGAGCGAGACUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 23 |
miR-424 directly targets SLC5A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-424 | miRNA Mature ID | miR-424-3p | ||
miRNA Sequence |
CAAAACGUGAGGCGCUGCUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 24 |
miR-4327 directly targets SLC5A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4327 | miRNA Mature ID | miR-4327 | ||
miRNA Sequence |
GGCUUGCAUGGGGGACUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 25 |
miR-4458 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4458 | miRNA Mature ID | miR-4458 | ||
miRNA Sequence |
AGAGGUAGGUGUGGAAGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 26 |
miR-4500 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4500 | miRNA Mature ID | miR-4500 | ||
miRNA Sequence |
UGAGGUAGUAGUUUCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 27 |
miR-4524a directly targets SLC5A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4524a | miRNA Mature ID | miR-4524a-3p | ||
miRNA Sequence |
UGAGACAGGCUUAUGCUGCUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 28 |
miR-4524b directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4524b | miRNA Mature ID | miR-4524b-3p | ||
miRNA Sequence |
GAGACAGGUUCAUGCUGCUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 29 |
miR-4712 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4712 | miRNA Mature ID | miR-4712-3p | ||
miRNA Sequence |
AAUGAGAGACCUGUACUGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 30 |
miR-4802 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4802 | miRNA Mature ID | miR-4802-5p | ||
miRNA Sequence |
UAUGGAGGUUCUAGACCAUGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 31 |
miR-548c directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548c | miRNA Mature ID | miR-548c-3p | ||
miRNA Sequence |
CAAAAAUCUCAAUUACUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 32 |
miR-577 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-577 | miRNA Mature ID | miR-577 | ||
miRNA Sequence |
UAGAUAAAAUAUUGGUACCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 33 |
miR-6085 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6085 | miRNA Mature ID | miR-6085 | ||
miRNA Sequence |
AAGGGGCUGGGGGAGCACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 34 |
miR-6124 directly targets SLC5A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6124 | miRNA Mature ID | miR-6124 | ||
miRNA Sequence |
GGGAAAAGGAAGGGGGAGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 35 |
miR-6134 directly targets SLC5A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6134 | miRNA Mature ID | miR-6134 | ||
miRNA Sequence |
UGAGGUGGUAGGAUGUAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 36 |
miR-636 directly targets SLC5A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-636 | miRNA Mature ID | miR-636 | ||
miRNA Sequence |
UGUGCUUGCUCGUCCCGCCCGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 37 |
miR-6515 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6515 | miRNA Mature ID | miR-6515-3p | ||
miRNA Sequence |
UCUCUUCAUCUACCCCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 38 |
miR-6813 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6813 | miRNA Mature ID | miR-6813-5p | ||
miRNA Sequence |
CAGGGGCUGGGGUUUCAGGUUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 39 |
miR-6831 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6831 | miRNA Mature ID | miR-6831-5p | ||
miRNA Sequence |
UAGGUAGAGUGUGAGGAGGAGGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 40 |
miR-6851 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6851 | miRNA Mature ID | miR-6851-5p | ||
miRNA Sequence |
AGGAGGUGGUACUAGGGGCCAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 41 |
miR-7854 directly targets SLC5A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7854 | miRNA Mature ID | miR-7854-3p | ||
miRNA Sequence |
UGAGGUGACCGCAGAUGGGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 42 |
miR-877 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-877 | miRNA Mature ID | miR-877-3p | ||
miRNA Sequence |
UCCUCUUCUCCCUCCUCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 43 |
miR-98 directly targets SLC5A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-98 | miRNA Mature ID | miR-98-5p | ||
miRNA Sequence |
UGAGGUAGUAAGUUGUAUUGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Methylation |
|||||
Meningioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC5A6 in meningioma than that in healthy individual | ||||
Studied Phenotype |
Meningioma [ICD-11:2A01.0Z] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.15E-28; Fold-change: -0.221255029; Z-score: -4.46508184 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC5A6 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.17E-27; Fold-change: -0.459501451; Z-score: -10.39856543 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Melanoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC5A6 in melanoma than that in healthy individual | ||||
Studied Phenotype |
Melanoma [ICD-11:2C30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 9.95E-05; Fold-change: -0.344477761; Z-score: -5.493650728 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.