Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0427 Transporter Info
Gene Name	SLC5A7
Transporter Name	High affinity choline transporter 1
Gene ID	60482
UniProt ID	Q9GZV3

Epigenetic Regulations of This DT (EGR)
Methylation
Lung squamous cell carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypomethylation of SLC5A7 in lung squamous cell carcinoma			[ 1 ]
Epigenetic Type	Methylation	Experiment Method	TCGA database
Related Molecular Changes	Up regulation of SLC5A7	Experiment Method	RNAseq
Studied Phenotype	Lung squamous cell carcinoma [ ICD-11: 2C25.2]
Experimental Material	Patient tissue samples
Additional Notes	SLC5A7 was upregulated and hypomethylated in lung squamous cell carcinoma.
Lung adenocarcinoma	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC5A7 in lung adenocarcinoma			[ 1 ]
Epigenetic Type	Methylation	Experiment Method	TCGA database
Related Molecular Changes	Down regulation of SLC5A7	Experiment Method	RNAseq
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Additional Notes	SLC5A7 had increased methylation and decreased expression in lung squamous cell carcinoma
Epigenetic Phenomenon 2	Methylation of SLC5A7 in lung adenocarcinoma			[ 10 ]
Location	5'UTR (cg06662812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 1.88E-03; Z-score: 2.91E+00
Methylation in Case	2.89E-01 (Median)	Methylation in Control	2.19E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A7 in lung adenocarcinoma			[ 10 ]
Location	5'UTR (cg07186154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.84E+00	Statistic Test	p-value: 1.98E-03; Z-score: 4.86E+00
Methylation in Case	2.76E-01 (Median)	Methylation in Control	1.49E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A7 in lung adenocarcinoma			[ 10 ]
Location	5'UTR (cg20547653)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 6.79E-03; Z-score: 1.96E+00
Methylation in Case	3.22E-01 (Median)	Methylation in Control	2.77E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A7 in lung adenocarcinoma			[ 10 ]
Location	TSS1500 (cg03983336)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 2.78E-03; Z-score: 1.83E+00
Methylation in Case	7.57E-01 (Median)	Methylation in Control	6.45E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC5A7 in lung adenocarcinoma			[ 10 ]
Location	TSS1500 (cg17679621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 1.76E-02; Z-score: 1.49E+00
Methylation in Case	3.67E-01 (Median)	Methylation in Control	3.02E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC5A7 in lung adenocarcinoma			[ 10 ]
Location	TSS200 (cg11355135)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.69E+00	Statistic Test	p-value: 2.29E-04; Z-score: 6.09E+00
Methylation in Case	4.29E-01 (Median)	Methylation in Control	2.54E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC5A7 in lung adenocarcinoma			[ 10 ]
Location	TSS200 (cg14613271)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.63E+00	Statistic Test	p-value: 2.02E-03; Z-score: 3.73E+00
Methylation in Case	2.21E-01 (Median)	Methylation in Control	1.35E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC5A7 in lung adenocarcinoma			[ 10 ]
Location	TSS200 (cg26001902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.73E+00	Statistic Test	p-value: 4.00E-03; Z-score: 4.99E+00
Methylation in Case	2.67E-01 (Median)	Methylation in Control	1.54E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC5A7 in lung adenocarcinoma			[ 10 ]
Location	TSS200 (cg18771173)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 8.92E-03; Z-score: 1.68E+00
Methylation in Case	1.59E-01 (Median)	Methylation in Control	1.15E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC5A7 in lung adenocarcinoma			[ 10 ]
Location	TSS200 (cg05311412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.51E+00	Statistic Test	p-value: 2.81E-02; Z-score: 2.60E+00
Methylation in Case	1.71E-01 (Median)	Methylation in Control	1.13E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC5A7 in lung adenocarcinoma			[ 10 ]
Location	Body (cg05099596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 3.75E-02; Z-score: -1.68E+00
Methylation in Case	7.66E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A7 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg06662812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.43E+00	Statistic Test	p-value: 6.68E-08; Z-score: -1.09E+00
Methylation in Case	3.42E-01 (Median)	Methylation in Control	4.89E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A7 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg07186154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 8.18E-08; Z-score: 1.45E+00
Methylation in Case	4.69E-01 (Median)	Methylation in Control	3.50E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A7 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg20547653)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 4.77E-06; Z-score: -1.16E+00
Methylation in Case	6.78E-01 (Median)	Methylation in Control	8.03E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A7 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	Body (cg05099596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.23E-03; Z-score: -1.96E-01
Methylation in Case	7.51E-01 (Median)	Methylation in Control	7.72E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A7 in bladder cancer			[ 3 ]
Location	5'UTR (cg20547653)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 1.37E-02; Z-score: -2.66E+00
Methylation in Case	1.64E-01 (Median)	Methylation in Control	1.92E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A7 in bladder cancer			[ 3 ]
Location	TSS1500 (cg17052964)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 6.81E-05; Z-score: 4.27E+00
Methylation in Case	7.43E-01 (Median)	Methylation in Control	6.84E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A7 in bladder cancer			[ 3 ]
Location	TSS1500 (cg03983336)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 2.01E-03; Z-score: 3.53E+00
Methylation in Case	7.71E-01 (Median)	Methylation in Control	6.71E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A7 in bladder cancer			[ 3 ]
Location	TSS200 (cg11355135)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+00	Statistic Test	p-value: 9.78E-03; Z-score: -3.89E+00
Methylation in Case	1.05E-01 (Median)	Methylation in Control	1.63E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A7 in bladder cancer			[ 3 ]
Location	Body (cg14772660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.33E+00	Statistic Test	p-value: 1.13E-11; Z-score: -1.38E+01
Methylation in Case	3.51E-01 (Median)	Methylation in Control	8.15E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A7 in breast cancer			[ 4 ]
Location	5'UTR (cg06662812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.42E+00	Statistic Test	p-value: 1.73E-11; Z-score: 2.36E+00
Methylation in Case	2.42E-01 (Median)	Methylation in Control	1.70E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A7 in breast cancer			[ 4 ]
Location	5'UTR (cg20547653)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 1.63E-09; Z-score: 1.64E+00
Methylation in Case	2.37E-01 (Median)	Methylation in Control	1.69E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A7 in breast cancer			[ 4 ]
Location	5'UTR (cg07186154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.07E+00	Statistic Test	p-value: 7.77E-08; Z-score: 1.62E+00
Methylation in Case	1.55E-01 (Median)	Methylation in Control	7.49E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A7 in breast cancer			[ 4 ]
Location	TSS1500 (cg17679621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.39E+00	Statistic Test	p-value: 2.83E-09; Z-score: 2.57E+00
Methylation in Case	3.99E-01 (Median)	Methylation in Control	2.87E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A7 in breast cancer			[ 4 ]
Location	TSS1500 (cg22415472)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 5.81E-08; Z-score: -2.15E+00
Methylation in Case	6.98E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC5A7 in breast cancer			[ 4 ]
Location	TSS1500 (cg03983336)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 1.40E-02; Z-score: 8.98E-01
Methylation in Case	7.28E-01 (Median)	Methylation in Control	6.76E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC5A7 in breast cancer			[ 4 ]
Location	TSS200 (cg11355135)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.79E+00	Statistic Test	p-value: 1.91E-15; Z-score: 3.20E+00
Methylation in Case	3.73E-01 (Median)	Methylation in Control	2.08E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC5A7 in breast cancer			[ 4 ]
Location	TSS200 (cg26001902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.80E+00	Statistic Test	p-value: 6.10E-15; Z-score: 3.48E+00
Methylation in Case	2.73E-01 (Median)	Methylation in Control	7.18E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC5A7 in breast cancer			[ 4 ]
Location	TSS200 (cg18771173)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.04E+00	Statistic Test	p-value: 2.20E-13; Z-score: 5.13E+00
Methylation in Case	2.00E-01 (Median)	Methylation in Control	4.95E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC5A7 in breast cancer			[ 4 ]
Location	TSS200 (cg14613271)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.41E+00	Statistic Test	p-value: 5.22E-12; Z-score: 2.84E+00
Methylation in Case	1.52E-01 (Median)	Methylation in Control	6.29E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC5A7 in breast cancer			[ 4 ]
Location	TSS200 (cg05311412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.93E+00	Statistic Test	p-value: 8.82E-12; Z-score: 3.09E+00
Methylation in Case	1.69E-01 (Median)	Methylation in Control	4.29E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC5A7 in breast cancer			[ 4 ]
Location	Body (cg05099596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 3.20E-08; Z-score: -2.11E+00
Methylation in Case	6.98E-01 (Median)	Methylation in Control	7.65E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC5A7 in breast cancer			[ 4 ]
Location	Body (cg14772660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.47E-03; Z-score: -3.14E-01
Methylation in Case	7.71E-01 (Median)	Methylation in Control	7.86E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A7 in clear cell renal cell carcinoma			[ 5 ]
Location	5'UTR (cg07186154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.14E+00	Statistic Test	p-value: 2.51E-05; Z-score: 1.24E+00
Methylation in Case	9.25E-02 (Median)	Methylation in Control	4.32E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A7 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg22415472)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.88E-08; Z-score: -3.91E+00
Methylation in Case	8.85E-01 (Median)	Methylation in Control	9.65E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A7 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg17679621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.49E+00	Statistic Test	p-value: 1.69E-05; Z-score: 2.44E+00
Methylation in Case	3.78E-01 (Median)	Methylation in Control	2.54E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A7 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS200 (cg26001902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.78E+00	Statistic Test	p-value: 7.58E-06; Z-score: 2.39E+00
Methylation in Case	9.18E-02 (Median)	Methylation in Control	3.30E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A7 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS200 (cg18771173)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.31E+00	Statistic Test	p-value: 3.61E-03; Z-score: 1.45E+00
Methylation in Case	4.25E-02 (Median)	Methylation in Control	3.24E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC5A7 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS200 (cg05311412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.42E+00	Statistic Test	p-value: 4.11E-03; Z-score: 2.49E+00
Methylation in Case	4.41E-02 (Median)	Methylation in Control	3.10E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC5A7 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS200 (cg14613271)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 4.53E-03; Z-score: 1.81E+00
Methylation in Case	5.39E-02 (Median)	Methylation in Control	4.06E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC5A7 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg05099596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 3.59E-06; Z-score: -2.08E+00
Methylation in Case	8.47E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A7 in colon adenocarcinoma			[ 6 ]
Location	5'UTR (cg26279668)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.98E+00	Statistic Test	p-value: 2.28E-07; Z-score: 6.24E+00
Methylation in Case	5.33E-01 (Median)	Methylation in Control	2.70E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A7 in colon adenocarcinoma			[ 6 ]
Location	5'UTR (cg13563026)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 1.08E-05; Z-score: -2.24E+00
Methylation in Case	2.67E-01 (Median)	Methylation in Control	3.46E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A7 in colon adenocarcinoma			[ 6 ]
Location	TSS1500 (cg14918082)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 5.85E-06; Z-score: 1.24E+00
Methylation in Case	7.43E-01 (Median)	Methylation in Control	6.42E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A7 in colon adenocarcinoma			[ 6 ]
Location	TSS1500 (cg26062856)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 5.90E-04; Z-score: -4.00E+00
Methylation in Case	5.57E-01 (Median)	Methylation in Control	6.51E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A7 in colon adenocarcinoma			[ 6 ]
Location	TSS1500 (cg19645639)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.52E+00	Statistic Test	p-value: 7.10E-04; Z-score: -1.56E+00
Methylation in Case	2.48E-01 (Median)	Methylation in Control	3.76E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC5A7 in colon adenocarcinoma			[ 6 ]
Location	TSS200 (cg09530407)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.67E+00	Statistic Test	p-value: 6.65E-04; Z-score: 2.97E+00
Methylation in Case	2.67E-01 (Median)	Methylation in Control	1.60E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC5A7 in colon adenocarcinoma			[ 6 ]
Location	Body (cg00465739)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.50E+00	Statistic Test	p-value: 3.32E-06; Z-score: -2.34E+00
Methylation in Case	3.54E-01 (Median)	Methylation in Control	5.30E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC5A7 in colon adenocarcinoma			[ 6 ]
Location	Body (cg14857792)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 1.33E-05; Z-score: -3.01E+00
Methylation in Case	5.41E-01 (Median)	Methylation in Control	6.79E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A7 in colorectal cancer			[ 7 ]
Location	5'UTR (cg07186154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.94E+00	Statistic Test	p-value: 1.96E-21; Z-score: 7.43E+00
Methylation in Case	4.31E-01 (Median)	Methylation in Control	1.09E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A7 in colorectal cancer			[ 7 ]
Location	5'UTR (cg06662812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.31E+00	Statistic Test	p-value: 2.04E-06; Z-score: 1.56E+00
Methylation in Case	6.06E-01 (Median)	Methylation in Control	4.63E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A7 in colorectal cancer			[ 7 ]
Location	5'UTR (cg20547653)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 1.09E-05; Z-score: 1.07E+00
Methylation in Case	3.21E-01 (Median)	Methylation in Control	2.46E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A7 in colorectal cancer			[ 7 ]
Location	TSS1500 (cg22415472)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 1.88E-12; Z-score: -4.65E+00
Methylation in Case	7.14E-01 (Median)	Methylation in Control	8.47E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A7 in colorectal cancer			[ 7 ]
Location	TSS1500 (cg17679621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 1.80E-05; Z-score: 1.47E+00
Methylation in Case	5.55E-01 (Median)	Methylation in Control	4.59E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC5A7 in colorectal cancer			[ 7 ]
Location	TSS200 (cg05311412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.43E+00	Statistic Test	p-value: 7.78E-17; Z-score: 6.69E+00
Methylation in Case	4.05E-01 (Median)	Methylation in Control	9.14E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC5A7 in colorectal cancer			[ 7 ]
Location	TSS200 (cg14613271)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.02E+00	Statistic Test	p-value: 1.23E-14; Z-score: 4.45E+00
Methylation in Case	3.65E-01 (Median)	Methylation in Control	1.21E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC5A7 in colorectal cancer			[ 7 ]
Location	TSS200 (cg18771173)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.86E+00	Statistic Test	p-value: 1.20E-13; Z-score: 3.78E+00
Methylation in Case	3.93E-01 (Median)	Methylation in Control	1.37E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC5A7 in colorectal cancer			[ 7 ]
Location	TSS200 (cg11355135)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.51E+00	Statistic Test	p-value: 4.63E-13; Z-score: 3.14E+00
Methylation in Case	6.93E-01 (Median)	Methylation in Control	4.59E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC5A7 in colorectal cancer			[ 7 ]
Location	TSS200 (cg26001902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.45E+00	Statistic Test	p-value: 1.21E-12; Z-score: 3.29E+00
Methylation in Case	5.49E-01 (Median)	Methylation in Control	2.24E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC5A7 in colorectal cancer			[ 7 ]
Location	Body (cg05099596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 5.76E-11; Z-score: -4.54E+00
Methylation in Case	7.91E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC5A7 in colorectal cancer			[ 7 ]
Location	Body (cg14772660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 4.45E-08; Z-score: -4.05E+00
Methylation in Case	8.53E-01 (Median)	Methylation in Control	9.12E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	5'UTR (cg20547653)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 2.53E-02; Z-score: 1.16E-02
Methylation in Case	1.95E-01 (Median)	Methylation in Control	1.94E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	5'UTR (cg06662812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 3.63E-02; Z-score: 1.60E-01
Methylation in Case	2.05E-01 (Median)	Methylation in Control	1.99E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	TSS1500 (cg19645639)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.43E+00	Statistic Test	p-value: 2.01E-19; Z-score: -2.46E+00
Methylation in Case	1.64E-01 (Median)	Methylation in Control	4.00E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	TSS1500 (cg09454187)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+00	Statistic Test	p-value: 1.26E-15; Z-score: -5.20E+00
Methylation in Case	4.75E-01 (Median)	Methylation in Control	7.36E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	TSS1500 (cg01109535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 2.14E-13; Z-score: -2.02E+00
Methylation in Case	3.35E-01 (Median)	Methylation in Control	4.51E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	TSS1500 (cg00826767)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 1.03E-10; Z-score: -1.76E+00
Methylation in Case	4.85E-01 (Median)	Methylation in Control	6.59E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	TSS1500 (cg17052964)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 3.37E-08; Z-score: -2.02E+00
Methylation in Case	5.42E-01 (Median)	Methylation in Control	6.72E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	TSS1500 (cg22415472)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 1.14E-06; Z-score: -1.29E+00
Methylation in Case	5.57E-01 (Median)	Methylation in Control	6.46E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	TSS1500 (cg03983336)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 3.58E-05; Z-score: -1.16E+00
Methylation in Case	4.91E-01 (Median)	Methylation in Control	5.87E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	TSS200 (cg11264635)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.57E+00	Statistic Test	p-value: 7.55E-21; Z-score: -4.89E+00
Methylation in Case	4.00E-01 (Median)	Methylation in Control	6.27E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	TSS200 (cg26001902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 6.37E-04; Z-score: 4.39E-01
Methylation in Case	1.46E-01 (Median)	Methylation in Control	1.14E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg15027358)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.87E+00	Statistic Test	p-value: 2.27E-21; Z-score: -1.32E+01
Methylation in Case	4.44E-01 (Median)	Methylation in Control	8.30E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg09358975)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.79E+00	Statistic Test	p-value: 8.64E-21; Z-score: -4.39E+00
Methylation in Case	4.13E-01 (Median)	Methylation in Control	7.41E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg12933431)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.56E+00	Statistic Test	p-value: 1.69E-16; Z-score: -2.32E+00
Methylation in Case	4.23E-01 (Median)	Methylation in Control	6.61E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg08739738)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+00	Statistic Test	p-value: 9.11E-12; Z-score: -2.35E+00
Methylation in Case	4.10E-01 (Median)	Methylation in Control	6.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC5A7 in hepatocellular carcinoma			[ 8 ]
Location	3'UTR (cg16920502)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.76E+00	Statistic Test	p-value: 2.66E-18; Z-score: -5.99E+00
Methylation in Case	4.13E-01 (Median)	Methylation in Control	7.30E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A7 in HIV infection			[ 9 ]
Location	5'UTR (cg07186154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.39E+00	Statistic Test	p-value: 6.93E-07; Z-score: 2.82E+00
Methylation in Case	1.80E-01 (Median)	Methylation in Control	7.52E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A7 in HIV infection			[ 9 ]
Location	5'UTR (cg06662812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 4.10E-06; Z-score: 2.19E+00
Methylation in Case	2.20E-01 (Median)	Methylation in Control	1.57E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A7 in HIV infection			[ 9 ]
Location	5'UTR (cg20547653)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.41E+00	Statistic Test	p-value: 1.46E-05; Z-score: 2.72E+00
Methylation in Case	2.21E-01 (Median)	Methylation in Control	1.57E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A7 in HIV infection			[ 9 ]
Location	TSS1500 (cg22415472)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.86E-02; Z-score: -6.46E-01
Methylation in Case	8.51E-01 (Median)	Methylation in Control	8.68E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A7 in HIV infection			[ 9 ]
Location	TSS1500 (cg17679621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 2.99E-02; Z-score: 5.48E-01
Methylation in Case	4.21E-01 (Median)	Methylation in Control	3.89E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC5A7 in HIV infection			[ 9 ]
Location	TSS1500 (cg17052964)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 3.60E-02; Z-score: 4.07E-01
Methylation in Case	7.08E-01 (Median)	Methylation in Control	6.91E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC5A7 in HIV infection			[ 9 ]
Location	TSS200 (cg26001902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.40E+00	Statistic Test	p-value: 1.37E-05; Z-score: 2.79E+00
Methylation in Case	2.51E-01 (Median)	Methylation in Control	1.05E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC5A7 in HIV infection			[ 9 ]
Location	TSS200 (cg18771173)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.94E+00	Statistic Test	p-value: 1.37E-05; Z-score: 2.15E+00
Methylation in Case	1.45E-01 (Median)	Methylation in Control	7.49E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC5A7 in HIV infection			[ 9 ]
Location	TSS200 (cg11355135)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 1.93E-05; Z-score: 1.47E+00
Methylation in Case	3.67E-01 (Median)	Methylation in Control	2.78E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC5A7 in HIV infection			[ 9 ]
Location	TSS200 (cg05311412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.43E+00	Statistic Test	p-value: 2.03E-04; Z-score: 1.29E+00
Methylation in Case	1.23E-01 (Median)	Methylation in Control	8.62E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC5A7 in HIV infection			[ 9 ]
Location	TSS200 (cg14613271)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 4.47E-04; Z-score: 9.21E-01
Methylation in Case	1.79E-01 (Median)	Methylation in Control	1.43E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A7 in pancretic ductal adenocarcinoma			[ 11 ]
Location	5'UTR (cg06696917)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 3.30E-02; Z-score: -2.67E-01
Methylation in Case	7.34E-02 (Median)	Methylation in Control	7.73E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A7 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS200 (cg10569606)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.90E+00	Statistic Test	p-value: 3.33E-51; Z-score: 9.62E+00
Methylation in Case	3.26E-01 (Median)	Methylation in Control	6.65E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A7 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg03049846)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 7.27E-33; Z-score: -4.29E+00
Methylation in Case	5.25E-01 (Median)	Methylation in Control	6.73E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A7 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg01792749)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 5.10E-04; Z-score: -1.03E+00
Methylation in Case	5.63E-01 (Median)	Methylation in Control	6.87E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A7 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg10333311)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 3.46E-03; Z-score: 8.65E-01
Methylation in Case	7.06E-01 (Median)	Methylation in Control	6.44E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Prostate cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A7 in prostate cancer			[ 12 ]
Location	5'UTR (cg13598790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 8.23E-03; Z-score: 2.34E+00
Methylation in Case	4.03E-02 (Median)	Methylation in Control	2.81E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A7 in prostate cancer			[ 12 ]
Location	5'UTR (cg14411266)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.57E+00	Statistic Test	p-value: 1.74E-02; Z-score: 3.34E+00
Methylation in Case	3.26E-01 (Median)	Methylation in Control	9.11E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A7 in prostate cancer			[ 12 ]
Location	TSS1500 (cg16729160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.01E+00	Statistic Test	p-value: 3.13E-02; Z-score: 4.40E+01
Methylation in Case	2.61E-01 (Median)	Methylation in Control	6.51E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A7 in prostate cancer			[ 12 ]
Location	TSS200 (cg25212131)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 3.46E-02; Z-score: 2.06E+00
Methylation in Case	6.94E-01 (Median)	Methylation in Control	6.16E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A7 in prostate cancer			[ 12 ]
Location	1stExon (cg04592706)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 1.18E-02; Z-score: 2.14E+00
Methylation in Case	9.57E-01 (Median)	Methylation in Control	9.35E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC5A7 in prostate cancer			[ 12 ]
Location	Body (cg20741386)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 8.85E-03; Z-score: 4.12E+00
Methylation in Case	9.12E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC5A7 in prostate cancer			[ 12 ]
Location	Body (cg08065122)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 1.65E-02; Z-score: 2.01E+00
Methylation in Case	8.38E-01 (Median)	Methylation in Control	6.97E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC5A7 in prostate cancer			[ 12 ]
Location	Body (cg09767076)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 1.88E-02; Z-score: 1.86E+00
Methylation in Case	7.54E-01 (Median)	Methylation in Control	6.10E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC5A7 in prostate cancer			[ 12 ]
Location	Body (cg13917287)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 4.71E-02; Z-score: 1.30E+00
Methylation in Case	9.42E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Significant hypermethylation of SLC5A7 in prostate cancer than that in healthy individual
Studied Phenotype	Prostate cancer [ICD-11:2C82]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.49E-23; Fold-change: 0.355725753; Z-score: 12.37408655
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Papillary thyroid cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A7 in papillary thyroid cancer			[ 13 ]
Location	TSS1500 (cg17679621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 4.81E-05; Z-score: 9.10E-01
Methylation in Case	1.96E-01 (Median)	Methylation in Control	1.61E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A7 in papillary thyroid cancer			[ 13 ]
Location	TSS1500 (cg03983336)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 5.08E-05; Z-score: 1.38E+00
Methylation in Case	7.54E-01 (Median)	Methylation in Control	6.78E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC5A7 in papillary thyroid cancer			[ 13 ]
Location	TSS1500 (cg22415472)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.18E-04; Z-score: -7.16E-01
Methylation in Case	9.25E-01 (Median)	Methylation in Control	9.36E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC5A7 in papillary thyroid cancer			[ 13 ]
Location	TSS200 (cg26001902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 3.32E-02; Z-score: 3.31E-01
Methylation in Case	9.45E-02 (Median)	Methylation in Control	8.56E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC5A7 in papillary thyroid cancer			[ 13 ]
Location	Body (cg05099596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.39E-06; Z-score: -9.42E-01
Methylation in Case	8.94E-01 (Median)	Methylation in Control	9.12E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC5A7 in papillary thyroid cancer			[ 13 ]
Location	Body (cg14772660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.58E-03; Z-score: -6.31E-01
Methylation in Case	8.94E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A7 in systemic lupus erythematosus			[ 14 ]
Location	TSS1500 (cg22415472)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 7.45E-03; Z-score: -1.64E-01
Methylation in Case	8.61E-01 (Median)	Methylation in Control	8.68E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A7 in systemic lupus erythematosus			[ 14 ]
Location	Body (cg05099596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 8.89E-03; Z-score: -2.12E-01
Methylation in Case	8.29E-01 (Median)	Methylation in Control	8.39E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC5A7 in panic disorder			[ 15 ]
Location	TSS200 (cg05311412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.86E-01	Statistic Test	p-value: 4.15E-02; Z-score: -1.04E-01
Methylation in Case	-3.45E+00 (Median)	Methylation in Control	-3.40E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC5A7 in panic disorder			[ 15 ]
Location	Body (cg14772660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 2.60E-03; Z-score: -4.20E-01
Methylation in Case	5.33E-01 (Median)	Methylation in Control	7.10E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Acute myeloid leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC5A7 in acute myeloid leukemia than that in healthy individual
Studied Phenotype	Acute myeloid leukemia [ICD-11:2A60]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.16E-10; Fold-change: 0.268524828; Z-score: 1.782379141
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Arterial aneurysm	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC5A7 in arterial aneurysm than that in healthy individual
Studied Phenotype	Arterial aneurysm [ICD-11:BD51]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.041071028; Fold-change: 0.200615629; Z-score: 1.201622885
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Medulloblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC5A7 in medulloblastoma than that in healthy individual
Studied Phenotype	Medulloblastoma [ICD-11:2A00.10]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.45E-84; Fold-change: 0.284692785; Z-score: 3.43781753
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Glioblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC5A7 in glioblastoma than that in healthy individual
Studied Phenotype	Glioblastoma [ICD-11:2A00.00]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 5.09E-07; Fold-change: 0.488277974; Z-score: 1.632505164
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC5A7 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.55E-29; Fold-change: 0.646338693; Z-score: 2.989648066
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Malignant astrocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC5A7 in malignant astrocytoma than that in healthy individual
Studied Phenotype	Malignant astrocytoma [ICD-11:2A00.12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.09E-45; Fold-change: 0.419423536; Z-score: 2.431163165
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC5A7 in melanoma than that in healthy individual
Studied Phenotype	Melanoma [ICD-11:2C30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000337613; Fold-change: 0.415145763; Z-score: 1.789280778
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC5A7 in oligodendroglial tumour than that in healthy individual
Studied Phenotype	Oligodendroglial tumour [ICD-11:2A00.Y1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 5.85E-15; Fold-change: 0.467967268; Z-score: 20.16011341
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC5A7 in oligodendroglioma than that in healthy individual
Studied Phenotype	Oligodendroglioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.96E-25; Fold-change: 0.537552899; Z-score: 2.486457956
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Prostate cancer metastasis	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC5A7 in prostate cancer metastasis than that in healthy individual
Studied Phenotype	Prostate cancer metastasis [ICD-11:2.00E+06]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.60E-08; Fold-change: 0.504448802; Z-score: 19.15159428
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Gastric cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC5A7 in gastric cancer than that in adjacent tissue
Studied Phenotype	Gastric cancer [ICD-11:2B72]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 5.43E-30; Fold-change: 0.356816744; Z-score: 39.55765806
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-192 directly targets SLC5A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-192	miRNA Mature ID	miR-192-3p
miRNA Sequence	CUGCCAAUUCCAUAGGUCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-323b directly targets SLC5A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-323b	miRNA Mature ID	miR-323b-3p
miRNA Sequence	CCCAAUACACGGUCGACCUCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-329 directly targets SLC5A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-329	miRNA Mature ID	miR-329-3p
miRNA Sequence	AACACACCUGGUUAACCUCUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-362 directly targets SLC5A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-362	miRNA Mature ID	miR-362-3p
miRNA Sequence	AACACACCUAUUCAAGGAUUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-3659 directly targets SLC5A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3659	miRNA Mature ID	miR-3659
miRNA Sequence	UGAGUGUUGUCUACGAGGGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-3941 directly targets SLC5A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3941	miRNA Mature ID	miR-3941
miRNA Sequence	UUACACACAACUGAGGAUCAUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-4658 directly targets SLC5A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4658	miRNA Mature ID	miR-4658
miRNA Sequence	GUGAGUGUGGAUCCUGGAGGAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-4789 directly targets SLC5A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4789	miRNA Mature ID	miR-4789-3p
miRNA Sequence	CACACAUAGCAGGUGUAUAUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-5589 directly targets SLC5A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5589	miRNA Mature ID	miR-5589-3p
miRNA Sequence	UGCACAUGGCAACCUAGCUCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-5692a directly targets SLC5A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5692a	miRNA Mature ID	miR-5692a
miRNA Sequence	CAAAUAAUACCACAGUGGGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-574 directly targets SLC5A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-574	miRNA Mature ID	miR-574-5p
miRNA Sequence	UGAGUGUGUGUGUGUGAGUGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-603 directly targets SLC5A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-603	miRNA Mature ID	miR-603
miRNA Sequence	CACACACUGCAAUUACUUUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-6790 directly targets SLC5A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6790	miRNA Mature ID	miR-6790-5p
miRNA Sequence	GUGAGUGUGGAUUUGGCGGGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-8485 directly targets SLC5A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8485	miRNA Mature ID	miR-8485
miRNA Sequence	CACACACACACACACACGUAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Exploring and comparing of the gene expression and methylation differences between lung adenocarcinoma and squamous cell carcinoma. J Cell Physiol. 2019 Apr;234(4):4454-4459.
2	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3	DNA Methylation Dynamics in Urological Tumors.
4	Genome-wide Scan for Methylation Profiles in Breast Cancer
5	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
7	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
12	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
14	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
16	Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
17	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence