Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0444 Transporter Info
Gene Name SLC6A12
Transporter Name Na(+)/Cl(-) betaine/GABA transporter
Gene ID
6539
UniProt ID
P48065
Epigenetic Regulations of This DT (EGR)

Methylation

  Ovarian cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypomethylation of SLC6A12 in ovarian cancer [ 1 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method Methylation-specific PCR

Related Molecular Changes

 Up regulation of SLC6A12 Experiment Method RT-qPCR

Studied Phenotype

 Ovarian cancer [ ICD-11: 2C73]

Experimental Material

 Multiple cell lines of human

Additional Notes

 SLC6A12 had decreased methylation and increased expression in ovarian cancer.

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A12 in bladder cancer [ 2 ]

Location

 TSS1500 (cg10508416)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.64E+00 Statistic Test p-value: 2.48E-09; Z-score: -6.72E+00

Methylation in Case

 4.25E-01 (Median) Methylation in Control 6.98E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A12 in breast cancer [ 3 ]

Location

 TSS1500 (cg06823681)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 6.06E-15; Z-score: -2.96E+00

Methylation in Case

 6.04E-01 (Median) Methylation in Control 7.44E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A12 in breast cancer [ 3 ]

Location

 TSS1500 (cg10508416)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 5.30E-04; Z-score: -7.22E-01

Methylation in Case

 6.60E-01 (Median) Methylation in Control 6.91E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A12 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg10508416)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 7.52E-12; Z-score: -4.21E+00

Methylation in Case

 7.60E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A12 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg06823681)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.28E-06; Z-score: -1.71E+00

Methylation in Case

 7.78E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A12 in HIV infection [ 5 ]

Location

 TSS1500 (cg06823681)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 8.31E-06; Z-score: -3.05E+00

Methylation in Case

 6.93E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A12 in HIV infection [ 5 ]

Location

 TSS1500 (cg10508416)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.16E-04; Z-score: -1.46E+00

Methylation in Case

 7.72E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A12 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg06823681)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 8.66E-07; Z-score: -4.20E+00

Methylation in Case

 6.61E-01 (Median) Methylation in Control 7.82E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A12 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg10508416)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 2.30E-03; Z-score: -2.61E+00

Methylation in Case

 7.15E-01 (Median) Methylation in Control 7.88E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A12 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS1500 (cg02998017)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.77E-05; Z-score: -7.12E-01

Methylation in Case

 8.19E-01 (Median) Methylation in Control 8.38E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A12 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS1500 (cg01178971)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 2.53E-02; Z-score: 5.91E-01

Methylation in Case

 5.08E-01 (Median) Methylation in Control 4.64E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A12 in panic disorder [ 8 ]

Location

 TSS1500 (cg06823681)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 2.49E-02; Z-score: 4.65E-01

Methylation in Case

 1.93E+00 (Median) Methylation in Control 1.74E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A12 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg19521693)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.73E+00 Statistic Test p-value: 2.86E-20; Z-score: -2.60E+00

Methylation in Case

 1.75E-01 (Median) Methylation in Control 3.02E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A12 in prostate cancer [ 10 ]

Location

 Body (cg09660365)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.25E+00 Statistic Test p-value: 8.84E-03; Z-score: 1.96E+01

Methylation in Case

 4.99E-01 (Median) Methylation in Control 2.22E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-335 directly targets SLC6A12 [ 11 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-342 directly targets SLC6A12 [ 12 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-342 miRNA Mature ID miR-342-3p

miRNA Sequence

 UCUCACACAGAAAUCGCACCCGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Aberrant Hypomethylation of Solute Carrier Family 6 Member 12 Promoter Induces Metastasis of Ovarian Cancer. Yonsei Med J. 2017 Jan;58(1):27-34.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
12 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.