Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0445 Transporter Info
Gene Name	SLC6A13
Transporter Name	Sodium- and chloride-dependent GABA transporter 2
Gene ID	6540
UniProt ID	Q9NSD5

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC6A13 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg20804101)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 4.88E-06; Z-score: 1.18E+00
Methylation in Case	9.04E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC6A13 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg26837644)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.54E+00	Statistic Test	p-value: 1.26E-05; Z-score: -1.04E+00
Methylation in Case	2.67E-01 (Median)	Methylation in Control	4.12E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC6A13 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg04647176)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 8.95E-04; Z-score: -5.10E-01
Methylation in Case	8.78E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC6A13 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg13880565)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 2.64E-11; Z-score: -1.81E+00
Methylation in Case	7.52E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC6A13 in bladder cancer			[ 2 ]
Location	5'UTR (cg26837644)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.84E+00	Statistic Test	p-value: 3.55E-06; Z-score: -5.20E+00
Methylation in Case	1.78E-01 (Median)	Methylation in Control	3.27E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC6A13 in bladder cancer			[ 2 ]
Location	5'UTR (cg20804101)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.66E+00	Statistic Test	p-value: 1.87E-05; Z-score: -4.75E+00
Methylation in Case	2.45E-01 (Median)	Methylation in Control	4.08E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC6A13 in bladder cancer			[ 2 ]
Location	TSS1500 (cg15966757)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.97E+00	Statistic Test	p-value: 1.89E-09; Z-score: -8.21E+00
Methylation in Case	3.45E-01 (Median)	Methylation in Control	6.81E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC6A13 in bladder cancer			[ 2 ]
Location	TSS1500 (cg01471111)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.86E+00	Statistic Test	p-value: 1.00E-08; Z-score: -9.86E+00
Methylation in Case	2.61E-01 (Median)	Methylation in Control	4.84E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC6A13 in bladder cancer			[ 2 ]
Location	TSS1500 (cg02523679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 7.21E-05; Z-score: -3.27E+00
Methylation in Case	4.40E-01 (Median)	Methylation in Control	5.68E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC6A13 in bladder cancer			[ 2 ]
Location	TSS200 (cg22505395)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.08E+00	Statistic Test	p-value: 5.23E-10; Z-score: -1.34E+01
Methylation in Case	1.97E-01 (Median)	Methylation in Control	4.09E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC6A13 in bladder cancer			[ 2 ]
Location	TSS200 (cg23176632)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.12E+00	Statistic Test	p-value: 1.16E-08; Z-score: -1.01E+01
Methylation in Case	1.16E-01 (Median)	Methylation in Control	2.47E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC6A13 in bladder cancer			[ 2 ]
Location	TSS200 (cg15607358)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.45E+00	Statistic Test	p-value: 3.59E-08; Z-score: -8.04E+00
Methylation in Case	8.09E-02 (Median)	Methylation in Control	1.98E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC6A13 in bladder cancer			[ 2 ]
Location	Body (cg21426686)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.94E+00	Statistic Test	p-value: 4.10E-10; Z-score: -1.53E+01
Methylation in Case	3.92E-01 (Median)	Methylation in Control	7.61E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC6A13 in bladder cancer			[ 2 ]
Location	Body (cg23675485)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 2.81E-06; Z-score: -1.14E+01
Methylation in Case	6.87E-01 (Median)	Methylation in Control	8.71E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC6A13 in bladder cancer			[ 2 ]
Location	Body (cg17384865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 5.47E-06; Z-score: -8.15E+00
Methylation in Case	7.33E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC6A13 in bladder cancer			[ 2 ]
Location	Body (cg20958098)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 9.25E-06; Z-score: -1.35E+01
Methylation in Case	6.54E-01 (Median)	Methylation in Control	8.26E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC6A13 in bladder cancer			[ 2 ]
Location	Body (cg04647176)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 9.01E-03; Z-score: -1.42E+00
Methylation in Case	8.77E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	5'UTR (cg20804101)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.59E+00	Statistic Test	p-value: 8.09E-16; Z-score: 2.85E+00
Methylation in Case	5.18E-01 (Median)	Methylation in Control	3.25E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	5'UTR (cg26837644)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.64E+00	Statistic Test	p-value: 3.50E-11; Z-score: 2.38E+00
Methylation in Case	4.30E-01 (Median)	Methylation in Control	2.62E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	TSS1500 (cg15966757)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 4.28E-19; Z-score: 3.28E+00
Methylation in Case	7.16E-01 (Median)	Methylation in Control	5.19E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	TSS1500 (cg01471111)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.42E+00	Statistic Test	p-value: 2.57E-11; Z-score: 2.89E+00
Methylation in Case	5.51E-01 (Median)	Methylation in Control	3.87E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	TSS1500 (cg02523679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.89E-04; Z-score: 1.14E+00
Methylation in Case	5.80E-01 (Median)	Methylation in Control	5.24E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	TSS200 (cg15607358)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.82E+00	Statistic Test	p-value: 2.66E-13; Z-score: 2.88E+00
Methylation in Case	2.45E-01 (Median)	Methylation in Control	1.35E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	TSS200 (cg22505395)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 4.10E-10; Z-score: 2.51E+00
Methylation in Case	4.35E-01 (Median)	Methylation in Control	3.21E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	TSS200 (cg23176632)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 2.96E-07; Z-score: 1.58E+00
Methylation in Case	2.58E-01 (Median)	Methylation in Control	1.93E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	Body (cg17384865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 7.45E-06; Z-score: -1.15E+00
Methylation in Case	8.54E-01 (Median)	Methylation in Control	8.73E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	Body (cg04647176)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.77E-05; Z-score: -1.04E+00
Methylation in Case	8.56E-01 (Median)	Methylation in Control	8.84E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	Body (cg21426686)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 7.38E-04; Z-score: -8.23E-01
Methylation in Case	6.76E-01 (Median)	Methylation in Control	7.54E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	Body (cg20958098)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.62E-03; Z-score: -4.94E-01
Methylation in Case	7.76E-01 (Median)	Methylation in Control	7.96E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	Body (cg23675485)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.91E-03; Z-score: -5.01E-01
Methylation in Case	8.51E-01 (Median)	Methylation in Control	8.71E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC6A13 in breast cancer			[ 3 ]
Location	3'UTR (cg13880565)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 6.96E-07; Z-score: 2.08E+00
Methylation in Case	7.03E-01 (Median)	Methylation in Control	6.04E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC6A13 in colorectal cancer			[ 4 ]
Location	5'UTR (cg20804101)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.28E-03; Z-score: 6.88E-01
Methylation in Case	7.66E-01 (Median)	Methylation in Control	7.04E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC6A13 in colorectal cancer			[ 4 ]
Location	Body (cg21426686)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 2.87E-14; Z-score: -8.20E+00
Methylation in Case	6.23E-01 (Median)	Methylation in Control	8.01E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC6A13 in colorectal cancer			[ 4 ]
Location	Body (cg20958098)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.29E-07; Z-score: -2.40E+00
Methylation in Case	8.42E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC6A13 in colorectal cancer			[ 4 ]
Location	Body (cg17384865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.44E-05; Z-score: -1.11E+00
Methylation in Case	9.33E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC6A13 in colorectal cancer			[ 4 ]
Location	Body (cg23675485)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.92E-04; Z-score: -1.00E+00
Methylation in Case	9.32E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC6A13 in colorectal cancer			[ 4 ]
Location	Body (cg04647176)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 2.75E-02; Z-score: -2.17E-01
Methylation in Case	9.35E-01 (Median)	Methylation in Control	9.38E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC6A13 in colorectal cancer			[ 4 ]
Location	3'UTR (cg13880565)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 4.74E-02; Z-score: -3.89E-01
Methylation in Case	7.69E-01 (Median)	Methylation in Control	7.95E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC6A13 in pancretic ductal adenocarcinoma			[ 5 ]
Location	5'UTR (cg05537253)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 3.81E-05; Z-score: 1.13E+00
Methylation in Case	5.37E-01 (Median)	Methylation in Control	4.98E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC6A13 in pancretic ductal adenocarcinoma			[ 5 ]
Location	TSS1500 (cg18426142)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.68E+00	Statistic Test	p-value: 7.12E-18; Z-score: -3.17E+00
Methylation in Case	2.38E-01 (Median)	Methylation in Control	3.99E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC6A13 in pancretic ductal adenocarcinoma			[ 5 ]
Location	TSS200 (cg06000883)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.04E+00	Statistic Test	p-value: 2.62E-06; Z-score: 1.57E+00
Methylation in Case	2.34E-01 (Median)	Methylation in Control	1.15E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC6A13 in pancretic ductal adenocarcinoma			[ 5 ]
Location	TSS200 (cg01323777)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 3.22E-04; Z-score: -1.22E+00
Methylation in Case	7.18E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC6A13 in pancretic ductal adenocarcinoma			[ 5 ]
Location	1stExon (cg05633391)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.69E+00	Statistic Test	p-value: 1.34E-14; Z-score: 1.46E+00
Methylation in Case	1.18E-01 (Median)	Methylation in Control	6.99E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC6A13 in pancretic ductal adenocarcinoma			[ 5 ]
Location	Body (cg16887170)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 7.52E-10; Z-score: 2.33E+00
Methylation in Case	8.03E-01 (Median)	Methylation in Control	6.90E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC6A13 in pancretic ductal adenocarcinoma			[ 5 ]
Location	Body (cg12675583)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 8.56E-08; Z-score: 1.33E+00
Methylation in Case	4.66E-01 (Median)	Methylation in Control	4.00E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC6A13 in pancretic ductal adenocarcinoma			[ 5 ]
Location	Body (cg22904711)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 6.68E-04; Z-score: 8.79E-01
Methylation in Case	5.05E-01 (Median)	Methylation in Control	3.97E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC6A13 in pancretic ductal adenocarcinoma			[ 5 ]
Location	Body (cg15469704)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 2.91E-02; Z-score: 3.63E-01
Methylation in Case	6.90E-01 (Median)	Methylation in Control	6.81E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Prostate cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC6A13 in prostate cancer			[ 6 ]
Location	5'UTR (cg06562372)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.20E+00	Statistic Test	p-value: 7.97E-03; Z-score: 1.39E+01
Methylation in Case	3.10E-01 (Median)	Methylation in Control	9.66E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC6A13 in prostate cancer			[ 6 ]
Location	TSS200 (cg09710316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 1.22E-02; Z-score: 2.12E+00
Methylation in Case	9.20E-01 (Median)	Methylation in Control	8.71E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC6A13 in prostate cancer			[ 6 ]
Location	Body (cg03001176)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 4.56E-03; Z-score: 3.10E+00
Methylation in Case	8.96E-01 (Median)	Methylation in Control	8.32E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC6A13 in prostate cancer			[ 6 ]
Location	Body (cg07185041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.46E+00	Statistic Test	p-value: 1.95E-02; Z-score: -2.34E+00
Methylation in Case	4.36E-01 (Median)	Methylation in Control	6.37E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC6A13 in prostate cancer			[ 6 ]
Location	Body (cg05062560)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 2.06E-02; Z-score: 2.18E+00
Methylation in Case	9.00E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC6A13 in prostate cancer			[ 6 ]
Location	3'UTR (cg14491707)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 2.69E-02; Z-score: -8.27E+00
Methylation in Case	4.53E-01 (Median)	Methylation in Control	6.27E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC6A13 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg01471111)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 9.59E-04; Z-score: 1.56E+00
Methylation in Case	7.85E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC6A13 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg02523679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 9.33E-03; Z-score: 7.17E-01
Methylation in Case	6.51E-01 (Median)	Methylation in Control	6.10E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC6A13 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg15607358)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 9.24E-03; Z-score: 1.34E+00
Methylation in Case	5.33E-01 (Median)	Methylation in Control	4.66E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC6A13 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg14506686)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+00	Statistic Test	p-value: 3.87E-17; Z-score: -8.52E+00
Methylation in Case	4.91E-01 (Median)	Methylation in Control	7.61E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC6A13 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg03479705)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.51E+00	Statistic Test	p-value: 1.24E-10; Z-score: -2.49E+00
Methylation in Case	2.24E-01 (Median)	Methylation in Control	3.39E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC6A13 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg06933862)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 5.21E-10; Z-score: -1.15E+01
Methylation in Case	7.88E-01 (Median)	Methylation in Control	9.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC6A13 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg04647176)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.26E-02; Z-score: -2.85E-01
Methylation in Case	8.71E-01 (Median)	Methylation in Control	8.78E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC6A13 in HIV infection			[ 8 ]
Location	TSS1500 (cg02523679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 4.71E-02; Z-score: 3.27E-01
Methylation in Case	7.57E-01 (Median)	Methylation in Control	7.45E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC6A13 in HIV infection			[ 8 ]
Location	TSS200 (cg15607358)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 2.74E-02; Z-score: 4.91E-01
Methylation in Case	4.66E-01 (Median)	Methylation in Control	4.31E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC6A13 in HIV infection			[ 8 ]
Location	TSS200 (cg22505395)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 2.76E-02; Z-score: 8.86E-01
Methylation in Case	7.19E-01 (Median)	Methylation in Control	6.83E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC6A13 in HIV infection			[ 8 ]
Location	Body (cg17384865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 3.88E-02; Z-score: 1.77E-01
Methylation in Case	9.35E-01 (Median)	Methylation in Control	9.32E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC6A13 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg01471111)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 4.44E-02; Z-score: 1.67E+00
Methylation in Case	6.47E-01 (Median)	Methylation in Control	5.82E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC6A13 in lung adenocarcinoma			[ 9 ]
Location	TSS200 (cg15607358)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 3.79E-02; Z-score: 1.43E+00
Methylation in Case	3.41E-01 (Median)	Methylation in Control	2.79E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC6A13 in lung adenocarcinoma			[ 9 ]
Location	Body (cg21426686)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 8.97E-05; Z-score: -3.83E+00
Methylation in Case	7.29E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC6A13 in lung adenocarcinoma			[ 9 ]
Location	Body (cg20958098)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 5.92E-03; Z-score: -2.00E+00
Methylation in Case	7.90E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC6A13 in papillary thyroid cancer			[ 10 ]
Location	TSS1500 (cg02523679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.48E-04; Z-score: -8.92E-01
Methylation in Case	7.26E-01 (Median)	Methylation in Control	7.57E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC6A13 in papillary thyroid cancer			[ 10 ]
Location	3'UTR (cg13880565)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 5.16E-07; Z-score: 1.71E+00
Methylation in Case	7.64E-01 (Median)	Methylation in Control	7.06E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC6A13 in systemic lupus erythematosus			[ 11 ]
Location	TSS200 (cg22505395)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.74E-02; Z-score: -2.58E-01
Methylation in Case	7.47E-01 (Median)	Methylation in Control	7.60E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC6A13 in systemic lupus erythematosus			[ 11 ]
Location	Body (cg22608964)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.07E-03; Z-score: -3.16E-01
Methylation in Case	8.89E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC6A13 in systemic lupus erythematosus			[ 11 ]
Location	Body (cg17384865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.85E-02; Z-score: -2.69E-01
Methylation in Case	9.20E-01 (Median)	Methylation in Control	9.26E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-421 directly targets SLC6A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-421	miRNA Mature ID	miR-421
miRNA Sequence	AUCAACAGACAUUAAUUGGGCGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 2	miR-4709 directly targets SLC6A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4709	miRNA Mature ID	miR-4709-5p
miRNA Sequence	ACAACAGUGACUUGCUCUCCAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
7	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12	Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence