Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0446 Transporter Info
Gene Name SLC6A14
Transporter Name Amino acid transporter ATB0+
Gene ID
11254
UniProt ID
Q9UN76
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A14 in bladder cancer [ 1 ]

Location

 TSS1500 (cg15659974)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.81E+00 Statistic Test p-value: 4.66E-12; Z-score: -1.11E+01

Methylation in Case

 2.37E-01 (Median) Methylation in Control 6.67E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A14 in bladder cancer [ 1 ]

Location

 TSS1500 (cg08975046)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 3.56E-02; Z-score: 1.01E-01

Methylation in Case

 8.61E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A14 in bladder cancer [ 1 ]

Location

 TSS200 (cg16857852)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.29E+00 Statistic Test p-value: 1.06E-10; Z-score: -1.05E+01

Methylation in Case

 1.99E-01 (Median) Methylation in Control 6.56E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC6A14 in bladder cancer [ 1 ]

Location

 TSS200 (cg02772823)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.32E+00 Statistic Test p-value: 5.06E-08; Z-score: -8.24E+00

Methylation in Case

 1.74E-01 (Median) Methylation in Control 5.79E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A14 in breast cancer [ 2 ]

Location

 TSS1500 (cg15659974)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 2.25E-07; Z-score: -1.65E+00

Methylation in Case

 4.94E-01 (Median) Methylation in Control 5.61E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A14 in breast cancer [ 2 ]

Location

 TSS200 (cg02772823)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 1.71E-14; Z-score: -2.90E+00

Methylation in Case

 3.74E-01 (Median) Methylation in Control 4.74E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A14 in breast cancer [ 2 ]

Location

 TSS200 (cg16857852)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 4.25E-14; Z-score: -2.40E+00

Methylation in Case

 4.52E-01 (Median) Methylation in Control 5.58E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC6A14 in breast cancer [ 2 ]

Location

 3'UTR (cg10990357)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 7.68E-03; Z-score: -7.66E-01

Methylation in Case

 7.84E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A14 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg15659974)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 5.09E-03; Z-score: -1.02E+00

Methylation in Case

 5.44E-01 (Median) Methylation in Control 6.42E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A14 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg08975046)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.95E-02; Z-score: 1.37E-01

Methylation in Case

 8.44E-01 (Median) Methylation in Control 8.38E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A14 in colorectal cancer [ 3 ]

Location

 TSS200 (cg16857852)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 8.72E-03; Z-score: -8.82E-01

Methylation in Case

 5.27E-01 (Median) Methylation in Control 6.37E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC6A14 in colorectal cancer [ 3 ]

Location

 TSS200 (cg02772823)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 4.38E-02; Z-score: -5.47E-01

Methylation in Case

 4.12E-01 (Median) Methylation in Control 4.75E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC6A14 in colorectal cancer [ 3 ]

Location

 Body (cg07358738)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.09E-02; Z-score: -4.81E-01

Methylation in Case

 8.63E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A14 in HIV infection [ 4 ]

Location

 TSS1500 (cg15659974)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 2.90E-03; Z-score: 8.45E-01

Methylation in Case

 7.63E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A14 in HIV infection [ 4 ]

Location

 TSS1500 (cg08975046)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 6.30E-03; Z-score: 4.52E-01

Methylation in Case

 8.84E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A14 in HIV infection [ 4 ]

Location

 Body (cg07358738)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 6.48E-03; Z-score: 6.94E-01

Methylation in Case

 8.98E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A14 in systemic lupus erythematosus [ 5 ]

Location

 TSS1500 (cg08975046)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.00E-05; Z-score: -4.90E-01

Methylation in Case

 7.91E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A14 in systemic lupus erythematosus [ 5 ]

Location

 TSS1500 (cg15659974)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.91E-02; Z-score: -1.60E-01

Methylation in Case

 6.99E-01 (Median) Methylation in Control 7.12E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A14 in systemic lupus erythematosus [ 5 ]

Location

 TSS200 (cg16857852)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.54E-03; Z-score: -3.49E-01

Methylation in Case

 7.01E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A14 in atypical teratoid rhabdoid tumor [ 6 ]

Location

 Body (cg07358738)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 3.84E-03; Z-score: -4.37E-01

Methylation in Case

 9.78E-01 (Median) Methylation in Control 9.81E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A14 in atypical teratoid rhabdoid tumor [ 6 ]

Location

 3'UTR (cg10990357)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 6.47E-12; Z-score: 1.84E+00

Methylation in Case

 8.50E-01 (Median) Methylation in Control 6.60E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A14 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg18101022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.13E+00 Statistic Test p-value: 2.54E-20; Z-score: 3.80E+00

Methylation in Case

 3.22E-01 (Median) Methylation in Control 1.03E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A14 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg17065011)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.47E-03; Z-score: -7.31E-01

Methylation in Case

 5.33E-01 (Median) Methylation in Control 5.44E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A14 in prostate cancer [ 8 ]

Location

 Body (cg21090075)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 1.03E-02; Z-score: 2.16E+00

Methylation in Case

 7.80E-01 (Median) Methylation in Control 5.96E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A14 in prostate cancer [ 8 ]

Location

 3'UTR (cg05303999)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 9.41E-03; Z-score: 2.16E+00

Methylation in Case

 8.64E-01 (Median) Methylation in Control 7.22E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Liver cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant/significant hypermethylation of SLC6A14 in liver cancer than that in healthy individual/adjacent tissue

Studied Phenotype

 Liver cancer [ICD-11:2C12]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 7.87E-13; Fold-change: -0.379228741; Z-score: -2.319226395

The Methylation Level of Disease Section Compare with the Adjacent Tissue

 p-value: 3.52E-14; Fold-change: -0.370640305; Z-score: -3.737168191
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section
Download DT methylation data in the tissue of healthy individual
Download DT methylation data in the tissue of the other disease section

  Ovarian cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC6A14 in ovarian cancer than that in healthy individual

Studied Phenotype

 Ovarian cancer [ICD-11:2C73]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.000308596; Fold-change: -0.203580579; Z-score: -1.558610825
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Peripheral neuroectodermal tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC6A14 in peripheral neuroectodermal tumour than that in healthy individual

Studied Phenotype

 Peripheral neuroectodermal tumour [ICD-11:2B52]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.000235501; Fold-change: -0.210237729; Z-score: -0.823280362
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Third ventricle chordoid glioma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypermethylation of SLC6A14 in third ventricle chordoid glioma than that in healthy individual

Studied Phenotype

 Third ventricle chordoid glioma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.019348251; Fold-change: 0.462530984; Z-score: 1.446611768
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Esthesioneuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC6A14 in esthesioneuroblastoma than that in healthy individual

Studied Phenotype

 Esthesioneuroblastoma [ICD-11:2D50.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 8.11E-07; Fold-change: -0.389127682; Z-score: -1.451300924
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Multilayered rosettes embryonal tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC6A14 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

 Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.24E-06; Fold-change: -0.379618626; Z-score: -1.51464688
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Lung cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC6A14 in lung cancer than that in adjacent tissue

Studied Phenotype

 Lung cancer [ICD-11:2C25]

The Methylation Level of Disease Section Compare with the Adjacent Tissue

 p-value: 5.48E-05; Fold-change: -0.234964225; Z-score: -2.87988164
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual
Download DT methylation data in the tissue of the other disease section

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-26b directly targets SLC6A14 [ 9 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
5 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
6 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.