Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0449 Transporter Info | ||||
| Gene Name | SLC6A17 | ||||
| Transporter Name | Sodium-dependent neurotransmitter transporter | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Atypical teratoid rhabdoid tumor |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.43E+00 | Statistic Test | p-value: 1.15E-08; Z-score: -1.80E+00 | ||
|
Methylation in Case |
5.11E-01 (Median) | Methylation in Control | 7.32E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 4.50E-08; Z-score: -1.71E+00 | ||
|
Methylation in Case |
7.45E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg05783233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.55E+00 | Statistic Test | p-value: 4.76E-08; Z-score: -1.64E+00 | ||
|
Methylation in Case |
3.58E-01 (Median) | Methylation in Control | 5.55E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 5.13E-08; Z-score: 1.65E+00 | ||
|
Methylation in Case |
6.39E-01 (Median) | Methylation in Control | 4.42E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 4.82E-07; Z-score: 1.13E+00 | ||
|
Methylation in Case |
7.07E-01 (Median) | Methylation in Control | 5.89E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 1.15E-06; Z-score: -1.27E+00 | ||
|
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 2.48E-04; Z-score: -6.33E-01 | ||
|
Methylation in Case |
3.38E-01 (Median) | Methylation in Control | 4.47E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 6.13E-04; Z-score: -5.26E-01 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg07587250) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.43E-03; Z-score: -6.04E-01 | ||
|
Methylation in Case |
9.16E-01 (Median) | Methylation in Control | 9.31E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg07598082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 4.45E-03; Z-score: 9.73E-01 | ||
|
Methylation in Case |
7.26E-01 (Median) | Methylation in Control | 6.04E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg11828251) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.54E-02; Z-score: -3.38E-01 | ||
|
Methylation in Case |
1.52E-01 (Median) | Methylation in Control | 1.65E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg12072789) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.66E-02; Z-score: 3.55E-01 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.54E+00 | Statistic Test | p-value: 4.39E-10; Z-score: -2.01E+00 | ||
|
Methylation in Case |
4.36E-01 (Median) | Methylation in Control | 6.69E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
18 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.81E+00 | Statistic Test | p-value: 1.14E-05; Z-score: -3.58E+00 | ||
|
Methylation in Case |
8.91E-02 (Median) | Methylation in Control | 1.61E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.87E+00 | Statistic Test | p-value: 3.31E-05; Z-score: 7.06E+00 | ||
|
Methylation in Case |
2.46E-01 (Median) | Methylation in Control | 1.32E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.12E+00 | Statistic Test | p-value: 3.95E-05; Z-score: 8.12E+00 | ||
|
Methylation in Case |
2.21E-01 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.39E+00 | Statistic Test | p-value: 4.81E-04; Z-score: 4.05E+00 | ||
|
Methylation in Case |
4.87E-01 (Median) | Methylation in Control | 3.50E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.11E+00 | Statistic Test | p-value: 1.33E-03; Z-score: 2.46E+00 | ||
|
Methylation in Case |
3.57E-02 (Median) | Methylation in Control | 1.70E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg05783233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 1.07E-02; Z-score: -2.53E+00 | ||
|
Methylation in Case |
2.62E-01 (Median) | Methylation in Control | 3.53E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg00961932) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.74E+00 | Statistic Test | p-value: 1.08E-07; Z-score: -6.93E+00 | ||
|
Methylation in Case |
8.90E-02 (Median) | Methylation in Control | 2.44E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg17032646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.64E+00 | Statistic Test | p-value: 1.15E-06; Z-score: 7.83E+00 | ||
|
Methylation in Case |
4.37E-01 (Median) | Methylation in Control | 2.66E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg10761097) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 1.29E-06; Z-score: -1.35E+01 | ||
|
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg23235497) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 7.51E-03; Z-score: 3.57E+00 | ||
|
Methylation in Case |
3.82E-01 (Median) | Methylation in Control | 2.99E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg11828251) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 1.36E-06; Z-score: -4.57E+00 | ||
|
Methylation in Case |
5.14E-01 (Median) | Methylation in Control | 6.87E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg12072789) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.57E+00 | Statistic Test | p-value: 2.08E-06; Z-score: -6.29E+00 | ||
|
Methylation in Case |
4.15E-01 (Median) | Methylation in Control | 6.50E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg19866406) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 2.89E-06; Z-score: -1.68E+01 | ||
|
Methylation in Case |
5.80E-01 (Median) | Methylation in Control | 7.52E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 5.70E-06; Z-score: -7.99E+00 | ||
|
Methylation in Case |
5.55E-01 (Median) | Methylation in Control | 7.30E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 1.64E-05; Z-score: -1.25E+01 | ||
|
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg07587250) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.57E+00 | Statistic Test | p-value: 8.05E-05; Z-score: -3.82E+00 | ||
|
Methylation in Case |
4.10E-01 (Median) | Methylation in Control | 6.45E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg07598082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 4.03E-04; Z-score: -3.43E+00 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.58E+00 | Statistic Test | p-value: 7.13E-08; Z-score: -1.04E+01 | ||
|
Methylation in Case |
4.44E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
16 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.60E+00 | Statistic Test | p-value: 1.47E-11; Z-score: 2.41E+00 | ||
|
Methylation in Case |
1.58E-01 (Median) | Methylation in Control | 9.87E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.45E+00 | Statistic Test | p-value: 8.43E-06; Z-score: 9.76E-01 | ||
|
Methylation in Case |
3.33E-02 (Median) | Methylation in Control | 2.30E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 5.91E-04; Z-score: 1.12E+00 | ||
|
Methylation in Case |
5.02E-01 (Median) | Methylation in Control | 4.32E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 6.80E-03; Z-score: -9.93E-01 | ||
|
Methylation in Case |
2.23E-01 (Median) | Methylation in Control | 3.23E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 1.40E-02; Z-score: 4.69E-01 | ||
|
Methylation in Case |
3.45E-01 (Median) | Methylation in Control | 3.10E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg00961932) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.60E+00 | Statistic Test | p-value: 2.31E-13; Z-score: -1.99E+00 | ||
|
Methylation in Case |
1.52E-01 (Median) | Methylation in Control | 2.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg10761097) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 1.28E-12; Z-score: -3.42E+00 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg23235497) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 4.42E-08; Z-score: 1.11E+00 | ||
|
Methylation in Case |
4.14E-01 (Median) | Methylation in Control | 3.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg17032646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 5.04E-05; Z-score: 7.85E-01 | ||
|
Methylation in Case |
4.45E-01 (Median) | Methylation in Control | 4.09E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg01202526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.07E+00 | Statistic Test | p-value: 4.03E-06; Z-score: 1.26E+00 | ||
|
Methylation in Case |
4.14E-02 (Median) | Methylation in Control | 2.00E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg07587250) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 1.20E-09; Z-score: -1.96E+00 | ||
|
Methylation in Case |
5.15E-01 (Median) | Methylation in Control | 6.85E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.99E-07; Z-score: -1.34E+00 | ||
|
Methylation in Case |
7.16E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg12072789) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 2.57E-07; Z-score: -1.87E+00 | ||
|
Methylation in Case |
5.84E-01 (Median) | Methylation in Control | 6.65E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg11828251) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.45E-07; Z-score: -1.27E+00 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 4.07E-05; Z-score: -9.36E-01 | ||
|
Methylation in Case |
8.34E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 1.49E-13; Z-score: -2.67E+00 | ||
|
Methylation in Case |
6.16E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.64E+00 | Statistic Test | p-value: 1.23E-05; Z-score: 1.46E+00 | ||
|
Methylation in Case |
8.51E-02 (Median) | Methylation in Control | 5.18E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.75E+00 | Statistic Test | p-value: 1.43E-05; Z-score: 2.60E+00 | ||
|
Methylation in Case |
8.34E-02 (Median) | Methylation in Control | 4.76E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 1.10E-03; Z-score: 3.00E+00 | ||
|
Methylation in Case |
5.27E-01 (Median) | Methylation in Control | 4.26E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 3.98E-03; Z-score: 5.99E-01 | ||
|
Methylation in Case |
1.92E-02 (Median) | Methylation in Control | 1.75E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A17 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg00961932) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.71E+00 | Statistic Test | p-value: 3.98E-02; Z-score: -2.09E+00 | ||
|
Methylation in Case |
1.74E-01 (Median) | Methylation in Control | 2.98E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.10E+00 | Statistic Test | p-value: 1.17E-19; Z-score: 4.82E+00 | ||
|
Methylation in Case |
5.87E-01 (Median) | Methylation in Control | 2.80E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+01 | Statistic Test | p-value: 1.59E-19; Z-score: 1.17E+01 | ||
|
Methylation in Case |
3.49E-01 (Median) | Methylation in Control | 3.11E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.70E+00 | Statistic Test | p-value: 2.83E-09; Z-score: 2.29E+00 | ||
|
Methylation in Case |
5.83E-01 (Median) | Methylation in Control | 3.43E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 5.19E-08; Z-score: 1.98E+00 | ||
|
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 6.77E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 4.67E-04; Z-score: -1.67E+00 | ||
|
Methylation in Case |
2.06E-01 (Median) | Methylation in Control | 2.81E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg05783233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 3.05E-03; Z-score: -1.50E+00 | ||
|
Methylation in Case |
5.17E-01 (Median) | Methylation in Control | 5.66E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg10761097) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 7.13E-05; Z-score: -9.10E-01 | ||
|
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg17032646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 2.06E-04; Z-score: 9.49E-01 | ||
|
Methylation in Case |
6.29E-01 (Median) | Methylation in Control | 5.80E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg01202526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.74E+00 | Statistic Test | p-value: 9.73E-13; Z-score: 9.35E+00 | ||
|
Methylation in Case |
1.95E-01 (Median) | Methylation in Control | 5.21E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg12072789) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 3.90E-14; Z-score: -3.42E+00 | ||
|
Methylation in Case |
6.65E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 7.95E-07; Z-score: -1.54E+00 | ||
|
Methylation in Case |
8.09E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg07598082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.44E-06; Z-score: -3.72E+00 | ||
|
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.57E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg19866406) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 5.93E-06; Z-score: -2.77E+00 | ||
|
Methylation in Case |
8.27E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg11828251) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.49E-04; Z-score: -1.42E+00 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.10E-03; Z-score: -6.17E-01 | ||
|
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 1.94E-12; Z-score: -3.44E+00 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Moderate hypermethylation of SLC6A17 in colorectal cancer than that in healthy individual | ||||
Studied Phenotype |
Colorectal cancer [ICD-11:2B91] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.02E-20; Fold-change: 0.241366751; Z-score: 2.59949617 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Depression |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in depression | [ 6 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.95E-02; Z-score: 4.68E-01 | ||
|
Methylation in Case |
3.56E-01 (Median) | Methylation in Control | 3.31E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in depression | [ 6 ] | |||
|
Location |
Body (cg07598082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.88E-02; Z-score: -5.21E-01 | ||
|
Methylation in Case |
9.23E-01 (Median) | Methylation in Control | 9.28E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
19 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 1.96E-04; Z-score: 2.17E-01 | ||
|
Methylation in Case |
2.99E-02 (Median) | Methylation in Control | 2.72E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 6.10E-04; Z-score: 2.63E-01 | ||
|
Methylation in Case |
1.21E-01 (Median) | Methylation in Control | 1.14E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.10E-02; Z-score: 2.35E-01 | ||
|
Methylation in Case |
1.66E-01 (Median) | Methylation in Control | 1.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
5'UTR (cg05783233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 3.84E-02; Z-score: -1.18E+00 | ||
|
Methylation in Case |
2.74E-01 (Median) | Methylation in Control | 3.22E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg09312996) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 5.62E-10; Z-score: -1.86E+00 | ||
|
Methylation in Case |
5.65E-01 (Median) | Methylation in Control | 6.26E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg10761097) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.05E-05; Z-score: -9.94E-01 | ||
|
Methylation in Case |
8.27E-01 (Median) | Methylation in Control | 8.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg00961932) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 2.09E-03; Z-score: -6.77E-01 | ||
|
Methylation in Case |
1.41E-01 (Median) | Methylation in Control | 1.69E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg23235497) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 1.20E-02; Z-score: -7.42E-01 | ||
|
Methylation in Case |
3.11E-01 (Median) | Methylation in Control | 3.45E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg02244028) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 7.11E-12; Z-score: -4.03E+00 | ||
|
Methylation in Case |
6.46E-01 (Median) | Methylation in Control | 7.83E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg01202526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 4.40E-03; Z-score: 1.29E-01 | ||
|
Methylation in Case |
4.10E-02 (Median) | Methylation in Control | 3.88E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg16397021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.84E+00 | Statistic Test | p-value: 9.14E-19; Z-score: -6.45E+00 | ||
|
Methylation in Case |
4.45E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg11842953) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.64E+00 | Statistic Test | p-value: 1.53E-15; Z-score: -8.59E+00 | ||
|
Methylation in Case |
5.58E-01 (Median) | Methylation in Control | 9.13E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg06622573) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 1.21E-11; Z-score: -4.56E+00 | ||
|
Methylation in Case |
5.12E-01 (Median) | Methylation in Control | 6.83E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg09050160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.56E+00 | Statistic Test | p-value: 8.76E-10; Z-score: -1.92E+00 | ||
|
Methylation in Case |
2.78E-01 (Median) | Methylation in Control | 4.32E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 2.42E-09; Z-score: -2.29E+00 | ||
|
Methylation in Case |
7.75E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg07598082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.81E-06; Z-score: -2.10E+00 | ||
|
Methylation in Case |
9.15E-01 (Median) | Methylation in Control | 9.54E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.87E-05; Z-score: -6.11E-01 | ||
|
Methylation in Case |
6.94E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
3'UTR (cg13080927) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.44E+00 | Statistic Test | p-value: 1.79E-16; Z-score: -3.28E+00 | ||
|
Methylation in Case |
4.37E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
3'UTR (cg18046311) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 4.32E-10; Z-score: -2.70E+00 | ||
|
Methylation in Case |
7.63E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
14 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.31E+00 | Statistic Test | p-value: 1.69E-05; Z-score: 1.49E+00 | ||
|
Methylation in Case |
1.94E-01 (Median) | Methylation in Control | 1.48E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 3.92E-04; Z-score: 1.52E+00 | ||
|
Methylation in Case |
1.44E-01 (Median) | Methylation in Control | 1.08E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 4.24E-04; Z-score: -5.52E-01 | ||
|
Methylation in Case |
2.90E-01 (Median) | Methylation in Control | 3.27E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.61E+00 | Statistic Test | p-value: 8.32E-04; Z-score: 1.49E+00 | ||
|
Methylation in Case |
2.48E-02 (Median) | Methylation in Control | 1.54E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 3.07E-03; Z-score: 4.14E-01 | ||
|
Methylation in Case |
4.63E-01 (Median) | Methylation in Control | 4.35E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg05783233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.79E-02; Z-score: 4.04E-01 | ||
|
Methylation in Case |
5.11E-01 (Median) | Methylation in Control | 4.86E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg00961932) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 1.54E-02; Z-score: 8.08E-01 | ||
|
Methylation in Case |
2.13E-01 (Median) | Methylation in Control | 1.74E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
TSS200 (cg01202526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 1.28E-02; Z-score: 7.52E-01 | ||
|
Methylation in Case |
4.07E-02 (Median) | Methylation in Control | 3.17E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg12072789) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.16E-04; Z-score: -1.36E+00 | ||
|
Methylation in Case |
7.02E-01 (Median) | Methylation in Control | 7.62E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.22E-04; Z-score: -1.36E+00 | ||
|
Methylation in Case |
7.04E-01 (Median) | Methylation in Control | 7.54E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg19866406) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 8.25E-04; Z-score: -8.56E-01 | ||
|
Methylation in Case |
8.79E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg07587250) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.49E-03; Z-score: -8.78E-01 | ||
|
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.64E-02; Z-score: -5.17E-01 | ||
|
Methylation in Case |
9.23E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 3.17E-06; Z-score: -3.21E+00 | ||
|
Methylation in Case |
6.97E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.43E+00 | Statistic Test | p-value: 6.54E-04; Z-score: 5.94E+00 | ||
|
Methylation in Case |
3.48E-01 (Median) | Methylation in Control | 1.43E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.70E+00 | Statistic Test | p-value: 8.99E-03; Z-score: 3.89E+00 | ||
|
Methylation in Case |
2.40E-01 (Median) | Methylation in Control | 1.41E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 2.76E-02; Z-score: 1.46E+00 | ||
|
Methylation in Case |
5.50E-01 (Median) | Methylation in Control | 4.34E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
5'UTR (cg05783233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 4.67E-02; Z-score: 1.19E+00 | ||
|
Methylation in Case |
4.81E-01 (Median) | Methylation in Control | 3.94E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg17032646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 4.47E-02; Z-score: 2.08E+00 | ||
|
Methylation in Case |
4.59E-01 (Median) | Methylation in Control | 3.87E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg01202526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.38E+00 | Statistic Test | p-value: 2.88E-02; Z-score: 1.15E+00 | ||
|
Methylation in Case |
5.84E-02 (Median) | Methylation in Control | 4.23E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 6.82E-03; Z-score: -3.29E+00 | ||
|
Methylation in Case |
6.90E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg07587250) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 4.33E-02; Z-score: -1.31E+00 | ||
|
Methylation in Case |
7.19E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 3.22E-03; Z-score: -2.53E+00 | ||
|
Methylation in Case |
6.25E-01 (Median) | Methylation in Control | 7.21E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in panic disorder | [ 10 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 8.14E-01 | Statistic Test | p-value: 1.33E-02; Z-score: 4.76E-01 | ||
|
Methylation in Case |
-1.09E+00 (Median) | Methylation in Control | -1.34E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in panic disorder | [ 10 ] | |||
|
Location |
Body (cg12072789) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 2.68E-05; Z-score: 5.78E-01 | ||
|
Methylation in Case |
1.82E+00 (Median) | Methylation in Control | 1.58E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in panic disorder | [ 10 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.05E-02; Z-score: 6.21E-01 | ||
|
Methylation in Case |
3.42E+00 (Median) | Methylation in Control | 3.26E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in panic disorder | [ 10 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 3.88E-03; Z-score: 5.70E-01 | ||
|
Methylation in Case |
2.26E+00 (Median) | Methylation in Control | 2.05E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 4.55E-04; Z-score: -1.06E+00 | ||
|
Methylation in Case |
1.99E-01 (Median) | Methylation in Control | 2.65E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 2.63E-03; Z-score: 6.10E-01 | ||
|
Methylation in Case |
8.70E-02 (Median) | Methylation in Control | 7.73E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 4.74E-03; Z-score: 7.08E-01 | ||
|
Methylation in Case |
9.04E-02 (Median) | Methylation in Control | 7.64E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 8.94E-05; Z-score: -9.04E-01 | ||
|
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 9.47E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A17 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 4.53E-08; Z-score: -1.34E+00 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.02E-02; Z-score: -1.87E-01 | ||
|
Methylation in Case |
3.13E-01 (Median) | Methylation in Control | 3.32E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
TSS1500 (cg23235497) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.75E-02; Z-score: -1.39E-01 | ||
|
Methylation in Case |
4.63E-01 (Median) | Methylation in Control | 4.70E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
TSS200 (cg01202526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 4.08E-02; Z-score: 4.56E-02 | ||
|
Methylation in Case |
2.82E-02 (Median) | Methylation in Control | 2.78E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg07587250) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.24E-02; Z-score: -2.09E-01 | ||
|
Methylation in Case |
8.26E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in colon adenocarcinoma | [ 13 ] | |||
|
Location |
TSS1500 (cg20822693) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 2.02E-04; Z-score: -2.23E+00 | ||
|
Methylation in Case |
6.42E-01 (Median) | Methylation in Control | 7.51E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in colon adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg15027358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 8.55E-06; Z-score: -7.34E+00 | ||
|
Methylation in Case |
7.29E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in colon adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg21090075) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 9.42E-06; Z-score: 3.57E+00 | ||
|
Methylation in Case |
5.99E-01 (Median) | Methylation in Control | 4.70E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in colon adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg24115232) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 6.38E-04; Z-score: 5.75E-01 | ||
|
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
TSS1500 (cg00910067) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 1.84E-07; Z-score: 1.88E+00 | ||
|
Methylation in Case |
3.77E-01 (Median) | Methylation in Control | 3.15E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
TSS200 (cg12392473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.43E+00 | Statistic Test | p-value: 4.35E-19; Z-score: 3.07E+00 | ||
|
Methylation in Case |
2.98E-01 (Median) | Methylation in Control | 8.69E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
TSS200 (cg13453520) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.51E+00 | Statistic Test | p-value: 4.41E-16; Z-score: 2.53E+00 | ||
|
Methylation in Case |
3.86E-01 (Median) | Methylation in Control | 2.55E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
TSS200 (cg26556895) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 1.12E-10; Z-score: 1.08E+00 | ||
|
Methylation in Case |
1.14E-01 (Median) | Methylation in Control | 8.80E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
TSS200 (cg21123160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.53E+00 | Statistic Test | p-value: 1.17E-07; Z-score: 1.70E+00 | ||
|
Methylation in Case |
5.23E-01 (Median) | Methylation in Control | 3.42E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
TSS200 (cg02666489) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.42E-03; Z-score: -4.77E-01 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg25090499) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.72E+00 | Statistic Test | p-value: 6.41E-21; Z-score: 3.45E+00 | ||
|
Methylation in Case |
3.20E-01 (Median) | Methylation in Control | 1.17E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg22544563) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.90E+00 | Statistic Test | p-value: 1.15E-09; Z-score: 1.34E+00 | ||
|
Methylation in Case |
1.55E-01 (Median) | Methylation in Control | 8.18E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg16405768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.13E-05; Z-score: 1.05E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 7.68E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg27665580) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.25E-03; Z-score: -5.41E-01 | ||
|
Methylation in Case |
7.46E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg16533977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.09E-02; Z-score: -2.87E-01 | ||
|
Methylation in Case |
9.23E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
TSS1500 (cg15806304) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 1.82E-02; Z-score: 2.17E+00 | ||
|
Methylation in Case |
7.98E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
TSS1500 (cg04152629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 3.02E-02; Z-score: 4.00E+00 | ||
|
Methylation in Case |
6.46E-02 (Median) | Methylation in Control | 4.47E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
TSS200 (cg24707219) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 1.18E-02; Z-score: -3.51E+00 | ||
|
Methylation in Case |
4.93E-01 (Median) | Methylation in Control | 6.71E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg05255811) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 4.37E-04; Z-score: 7.41E+00 | ||
|
Methylation in Case |
8.49E-01 (Median) | Methylation in Control | 6.80E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg02881274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.76E+00 | Statistic Test | p-value: 1.13E-02; Z-score: 8.78E+00 | ||
|
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 3.12E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg26411522) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 1.43E-02; Z-score: -2.70E+00 | ||
|
Methylation in Case |
4.77E-01 (Median) | Methylation in Control | 6.93E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg13665414) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 4.89E-02; Z-score: 1.30E+00 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 6.29E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Glioblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC6A17 in glioblastoma than that in healthy individual | ||||
Studied Phenotype |
Glioblastoma [ICD-11:2A00.00] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.011691749; Fold-change: 0.285895092; Z-score: 0.899267721 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC6A17 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.79E-18; Fold-change: 0.518573345; Z-score: 2.246156851 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypermethylation/moderate hypomethylation of SLC6A17 in gastric cancer than that in adjacent tissue/other disease section | ||||
Studied Phenotype |
Gastric cancer [ICD-11:2B72] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value: 4.94E-39; Fold-change: 0.281747423; Z-score: 38.43756811 | ||||
The Methylation Level of Disease Section Compare with the Other Disease Section |
p-value: .; Fold-change: .; Z-score: . | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
microRNA |
|||||
|
Unclear Phenotype |
43 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-1236 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1236 | miRNA Mature ID | miR-1236-5p | ||
|
miRNA Sequence |
UGAGUGACAGGGGAAAUGGGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 2 |
miR-128 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-128 | miRNA Mature ID | miR-128-3p | ||
|
miRNA Sequence |
UCACAGUGAACCGGUCUCUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 3 |
miR-1321 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1321 | miRNA Mature ID | miR-1321 | ||
|
miRNA Sequence |
CAGGGAGGUGAAUGUGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 4 |
miR-185 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-185 | miRNA Mature ID | miR-185-5p | ||
|
miRNA Sequence |
UGGAGAGAAAGGCAGUUCCUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 5 |
miR-216a directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-216a | miRNA Mature ID | miR-216a-3p | ||
|
miRNA Sequence |
UCACAGUGGUCUCUGGGAUUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 6 |
miR-27a directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-27a | miRNA Mature ID | miR-27a-3p | ||
|
miRNA Sequence |
UUCACAGUGGCUAAGUUCCGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 7 |
miR-27b directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-27b | miRNA Mature ID | miR-27b-3p | ||
|
miRNA Sequence |
UUCACAGUGGCUAAGUUCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 8 |
miR-3180 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3180 | miRNA Mature ID | miR-3180-5p | ||
|
miRNA Sequence |
CUUCCAGACGCUCCGCCCCACGUCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 9 |
miR-3681 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3681 | miRNA Mature ID | miR-3681-3p | ||
|
miRNA Sequence |
ACACAGUGCUUCAUCCACUACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-3689d directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3689d | miRNA Mature ID | miR-3689d | ||
|
miRNA Sequence |
GGGAGGUGUGAUCUCACACUCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 11 |
miR-4267 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4267 | miRNA Mature ID | miR-4267 | ||
|
miRNA Sequence |
UCCAGCUCGGUGGCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 12 |
miR-4270 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4270 | miRNA Mature ID | miR-4270 | ||
|
miRNA Sequence |
UCAGGGAGUCAGGGGAGGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 13 |
miR-4286 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4286 | miRNA Mature ID | miR-4286 | ||
|
miRNA Sequence |
ACCCCACUCCUGGUACC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 14 |
miR-4306 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4306 | miRNA Mature ID | miR-4306 | ||
|
miRNA Sequence |
UGGAGAGAAAGGCAGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 15 |
miR-4433a directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4433a | miRNA Mature ID | miR-4433a-5p | ||
|
miRNA Sequence |
CGUCCCACCCCCCACUCCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 16 |
miR-4441 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4441 | miRNA Mature ID | miR-4441 | ||
|
miRNA Sequence |
ACAGGGAGGAGAUUGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 17 |
miR-4510 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4510 | miRNA Mature ID | miR-4510 | ||
|
miRNA Sequence |
UGAGGGAGUAGGAUGUAUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 18 |
miR-4644 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4644 | miRNA Mature ID | miR-4644 | ||
|
miRNA Sequence |
UGGAGAGAGAAAAGAGACAGAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 19 |
miR-4697 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4697 | miRNA Mature ID | miR-4697-3p | ||
|
miRNA Sequence |
UGUCAGUGACUCCUGCCCCUUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 20 |
miR-4739 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4739 | miRNA Mature ID | miR-4739 | ||
|
miRNA Sequence |
AAGGGAGGAGGAGCGGAGGGGCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 21 |
miR-4756 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4756 | miRNA Mature ID | miR-4756-5p | ||
|
miRNA Sequence |
CAGGGAGGCGCUCACUCUCUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 22 |
miR-4765 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4765 | miRNA Mature ID | miR-4765 | ||
|
miRNA Sequence |
UGAGUGAUUGAUAGCUAUGUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 23 |
miR-513a directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-513a | miRNA Mature ID | miR-513a-5p | ||
|
miRNA Sequence |
UUCACAGGGAGGUGUCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 24 |
miR-6127 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6127 | miRNA Mature ID | miR-6127 | ||
|
miRNA Sequence |
UGAGGGAGUGGGUGGGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 25 |
miR-6129 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6129 | miRNA Mature ID | miR-6129 | ||
|
miRNA Sequence |
UGAGGGAGUUGGGUGUAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 26 |
miR-6130 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6130 | miRNA Mature ID | miR-6130 | ||
|
miRNA Sequence |
UGAGGGAGUGGAUUGUAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 27 |
miR-6133 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6133 | miRNA Mature ID | miR-6133 | ||
|
miRNA Sequence |
UGAGGGAGGAGGUUGGGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 28 |
miR-627 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-627 | miRNA Mature ID | miR-627-3p | ||
|
miRNA Sequence |
UCUUUUCUUUGAGACUCACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 29 |
miR-6512 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6512 | miRNA Mature ID | miR-6512-3p | ||
|
miRNA Sequence |
UUCCAGCCCUUCUAAUGGUAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 30 |
miR-6720 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6720 | miRNA Mature ID | miR-6720-5p | ||
|
miRNA Sequence |
UUCCAGCCCUGGUAGGCGCCGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 31 |
miR-6731 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6731 | miRNA Mature ID | miR-6731-5p | ||
|
miRNA Sequence |
UGGGAGAGCAGGGUAUUGUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 32 |
miR-6754 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6754 | miRNA Mature ID | miR-6754-5p | ||
|
miRNA Sequence |
CCAGGGAGGCUGGUUUGGAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 33 |
miR-6758 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6758 | miRNA Mature ID | miR-6758-5p | ||
|
miRNA Sequence |
UAGAGAGGGGAAGGAUGUGAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 34 |
miR-6760 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6760 | miRNA Mature ID | miR-6760-5p | ||
|
miRNA Sequence |
CAGGGAGAAGGUGGAAGUGCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 35 |
miR-6793 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6793 | miRNA Mature ID | miR-6793-3p | ||
|
miRNA Sequence |
UCCCCAACCCCUGCCCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 36 |
miR-6799 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6799 | miRNA Mature ID | miR-6799-5p | ||
|
miRNA Sequence |
GGGGAGGUGUGCAGGGCUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 37 |
miR-6851 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6851 | miRNA Mature ID | miR-6851-5p | ||
|
miRNA Sequence |
AGGAGGUGGUACUAGGGGCCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 38 |
miR-6856 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6856 | miRNA Mature ID | miR-6856-5p | ||
|
miRNA Sequence |
AAGAGAGGAGCAGUGGUGCUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 39 |
miR-6873 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6873 | miRNA Mature ID | miR-6873-5p | ||
|
miRNA Sequence |
CAGAGGGAAUACAGAGGGCAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 40 |
miR-7151 directly targets SLC6A17 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7151 | miRNA Mature ID | miR-7151-5p | ||
|
miRNA Sequence |
GAUCCAUCUCUGCCUGUAUUGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 41 |
miR-7151 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7151 | miRNA Mature ID | miR-7151-3p | ||
|
miRNA Sequence |
CUACAGGCUGGAAUGGGCUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 42 |
miR-7854 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7854 | miRNA Mature ID | miR-7854-3p | ||
|
miRNA Sequence |
UGAGGUGACCGCAGAUGGGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 43 |
miR-8085 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8085 | miRNA Mature ID | miR-8085 | ||
|
miRNA Sequence |
UGGGAGAGAGGACUGUGAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.