Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0451 Transporter Info | ||||
| Gene Name | SLC6A19 | ||||
| Transporter Name | Sodium-dependent neutral amino acid transporter B(0)AT1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Colon cancer |
16 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg20227806) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.28E+00 | Statistic Test | p-value: 1.50E-06; Z-score: 3.99E+00 | ||
|
Methylation in Case |
4.16E-01 (Median) | Methylation in Control | 1.82E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg10362591) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.65E+00 | Statistic Test | p-value: 3.89E-07; Z-score: 3.20E+00 | ||
|
Methylation in Case |
6.34E-01 (Median) | Methylation in Control | 3.83E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg01078332) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.43E+00 | Statistic Test | p-value: 2.19E-06; Z-score: -2.08E+00 | ||
|
Methylation in Case |
3.31E-01 (Median) | Methylation in Control | 4.73E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg22685409) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 3.61E-05; Z-score: 1.41E+00 | ||
|
Methylation in Case |
5.22E-01 (Median) | Methylation in Control | 4.15E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg15786180) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.46E+00 | Statistic Test | p-value: 7.94E-05; Z-score: 2.30E+00 | ||
|
Methylation in Case |
4.34E-01 (Median) | Methylation in Control | 2.98E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg23391214) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 2.74E-03; Z-score: -1.21E+00 | ||
|
Methylation in Case |
2.30E-01 (Median) | Methylation in Control | 3.09E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg21575465) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 3.19E-03; Z-score: -1.00E+00 | ||
|
Methylation in Case |
6.92E-01 (Median) | Methylation in Control | 7.37E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg26001902) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.82E+00 | Statistic Test | p-value: 1.16E-05; Z-score: 2.18E+00 | ||
|
Methylation in Case |
7.23E-01 (Median) | Methylation in Control | 3.97E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg22708635) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 1.71E-05; Z-score: 1.79E+00 | ||
|
Methylation in Case |
7.05E-01 (Median) | Methylation in Control | 6.31E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg20561863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 3.65E-05; Z-score: -2.25E+00 | ||
|
Methylation in Case |
2.87E-01 (Median) | Methylation in Control | 4.25E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg14009098) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.39E+00 | Statistic Test | p-value: 4.45E-05; Z-score: 2.58E+00 | ||
|
Methylation in Case |
6.05E-01 (Median) | Methylation in Control | 4.36E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg03723715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 1.48E-04; Z-score: -3.10E+00 | ||
|
Methylation in Case |
5.41E-01 (Median) | Methylation in Control | 6.30E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg27249906) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.01E-03; Z-score: -1.55E+00 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.63E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg02629157) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.48E-03; Z-score: -1.22E+00 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg00098175) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.65E-03; Z-score: 8.27E-01 | ||
|
Methylation in Case |
9.02E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg04330389) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.77E-03; Z-score: -1.23E+00 | ||
|
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 9.51E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
25 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg18673401) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.51E+00 | Statistic Test | p-value: 1.49E-12; Z-score: 1.60E+00 | ||
|
Methylation in Case |
1.57E-01 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg09696301) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.37E+00 | Statistic Test | p-value: 1.66E-22; Z-score: 3.29E+00 | ||
|
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 1.01E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg22901008) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 2.57E-08; Z-score: 8.39E-01 | ||
|
Methylation in Case |
2.37E-01 (Median) | Methylation in Control | 1.94E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg03983336) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 9.72E-07; Z-score: 1.49E+00 | ||
|
Methylation in Case |
7.20E-01 (Median) | Methylation in Control | 5.42E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg14535884) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.50E+00 | Statistic Test | p-value: 4.21E-06; Z-score: -1.06E+00 | ||
|
Methylation in Case |
1.39E-01 (Median) | Methylation in Control | 2.08E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg23502298) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 4.86E-02; Z-score: -7.85E-01 | ||
|
Methylation in Case |
3.42E-01 (Median) | Methylation in Control | 3.91E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg01325409) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 2.07E-10; Z-score: -1.66E+00 | ||
|
Methylation in Case |
5.63E-01 (Median) | Methylation in Control | 6.33E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg12135976) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.36E+00 | Statistic Test | p-value: 1.29E-05; Z-score: 9.50E-01 | ||
|
Methylation in Case |
2.90E-01 (Median) | Methylation in Control | 2.13E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg12799349) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 2.38E-05; Z-score: -1.24E+00 | ||
|
Methylation in Case |
1.26E-01 (Median) | Methylation in Control | 1.53E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg18153630) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 2.84E-04; Z-score: -1.39E+00 | ||
|
Methylation in Case |
1.91E-01 (Median) | Methylation in Control | 2.59E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg14373018) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 4.58E-04; Z-score: -5.27E-01 | ||
|
Methylation in Case |
5.78E-01 (Median) | Methylation in Control | 6.37E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg03464896) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.67E-02; Z-score: -1.54E-02 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
1stExon (cg26923754) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 1.16E-09; Z-score: 1.77E+00 | ||
|
Methylation in Case |
5.89E-01 (Median) | Methylation in Control | 4.82E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg04491808) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 1.48E-12; Z-score: 2.59E+00 | ||
|
Methylation in Case |
6.51E-01 (Median) | Methylation in Control | 5.63E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg12671565) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 3.26E-12; Z-score: -1.23E+00 | ||
|
Methylation in Case |
6.59E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg06483795) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 2.20E-10; Z-score: 1.96E+00 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg23368787) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 1.07E-08; Z-score: 1.81E+00 | ||
|
Methylation in Case |
5.24E-01 (Median) | Methylation in Control | 4.07E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg22120714) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.40E+00 | Statistic Test | p-value: 2.44E-06; Z-score: 1.32E+00 | ||
|
Methylation in Case |
1.86E-01 (Median) | Methylation in Control | 7.75E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg08701543) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 3.01E-06; Z-score: 1.62E+00 | ||
|
Methylation in Case |
7.37E-01 (Median) | Methylation in Control | 6.57E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 8.32E-04; Z-score: 8.75E-01 | ||
|
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 6.45E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg00472281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 3.71E-03; Z-score: -8.08E-01 | ||
|
Methylation in Case |
6.82E-01 (Median) | Methylation in Control | 7.63E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg13849066) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.30E-02; Z-score: -7.29E-03 | ||
|
Methylation in Case |
9.46E-01 (Median) | Methylation in Control | 9.47E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg17044311) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.72E-02; Z-score: -3.46E-01 | ||
|
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 8.56E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg26175729) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 2.16E-02; Z-score: -3.87E-01 | ||
|
Methylation in Case |
2.58E-01 (Median) | Methylation in Control | 2.94E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg24945881) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 8.46E-04; Z-score: -6.90E-01 | ||
|
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
|
Location |
5'UTR (cg09300114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.17E+00 | Statistic Test | p-value: 2.60E-04; Z-score: 1.59E+01 | ||
|
Methylation in Case |
7.66E-01 (Median) | Methylation in Control | 2.41E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.09E+00 | Statistic Test | p-value: 7.42E-04; Z-score: 2.21E+01 | ||
|
Methylation in Case |
5.96E-01 (Median) | Methylation in Control | 1.46E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg20313963) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.56E+00 | Statistic Test | p-value: 1.39E-03; Z-score: 4.14E+00 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 5.31E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg24900663) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.92E+00 | Statistic Test | p-value: 9.72E-03; Z-score: -2.63E+00 | ||
|
Methylation in Case |
9.95E-02 (Median) | Methylation in Control | 1.91E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
|
Location |
TSS200 (cg20095851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 1.92E-02; Z-score: 2.35E+00 | ||
|
Methylation in Case |
8.30E-01 (Median) | Methylation in Control | 7.42E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
|
Location |
Body (cg24866407) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 1.19E-02; Z-score: 3.74E+00 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 6.37E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
|
Location |
3'UTR (cg10024478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.23E+00 | Statistic Test | p-value: 2.20E-02; Z-score: 1.85E+00 | ||
|
Methylation in Case |
7.29E-01 (Median) | Methylation in Control | 5.91E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
48 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg11123744) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.28E+00 | Statistic Test | p-value: 1.77E-10; Z-score: -1.90E+01 | ||
|
Methylation in Case |
2.29E-01 (Median) | Methylation in Control | 5.23E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg26711638) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.38E+00 | Statistic Test | p-value: 1.77E-10; Z-score: -9.56E+00 | ||
|
Methylation in Case |
2.11E-01 (Median) | Methylation in Control | 5.03E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg11325573) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.50E+00 | Statistic Test | p-value: 2.05E-09; Z-score: -9.22E+00 | ||
|
Methylation in Case |
2.54E-01 (Median) | Methylation in Control | 3.82E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg02389859) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.89E+00 | Statistic Test | p-value: 1.33E-11; Z-score: -1.53E+01 | ||
|
Methylation in Case |
2.66E-01 (Median) | Methylation in Control | 5.02E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg21487099) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.66E+00 | Statistic Test | p-value: 9.85E-11; Z-score: -8.59E+00 | ||
|
Methylation in Case |
3.40E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg04309194) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.68E+00 | Statistic Test | p-value: 1.01E-10; Z-score: -1.07E+01 | ||
|
Methylation in Case |
3.82E-01 (Median) | Methylation in Control | 6.42E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg26948274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.63E+00 | Statistic Test | p-value: 7.32E-10; Z-score: -8.75E+00 | ||
|
Methylation in Case |
2.86E-01 (Median) | Methylation in Control | 4.67E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg09837037) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.74E+00 | Statistic Test | p-value: 2.33E-09; Z-score: -7.46E+00 | ||
|
Methylation in Case |
4.21E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg21492882) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.66E+00 | Statistic Test | p-value: 8.44E-09; Z-score: -7.25E+00 | ||
|
Methylation in Case |
3.26E-01 (Median) | Methylation in Control | 5.41E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg02685680) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.88E+00 | Statistic Test | p-value: 6.08E-17; Z-score: -1.94E+01 | ||
|
Methylation in Case |
3.98E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg24114651) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.63E+00 | Statistic Test | p-value: 1.41E-13; Z-score: -1.90E+01 | ||
|
Methylation in Case |
2.85E-01 (Median) | Methylation in Control | 7.50E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg24041118) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.04E+00 | Statistic Test | p-value: 2.24E-13; Z-score: -3.94E+01 | ||
|
Methylation in Case |
4.00E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg00472281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.24E+00 | Statistic Test | p-value: 2.97E-13; Z-score: -1.42E+01 | ||
|
Methylation in Case |
3.01E-01 (Median) | Methylation in Control | 6.76E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg09517450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.03E+00 | Statistic Test | p-value: 1.24E-12; Z-score: -2.16E+01 | ||
|
Methylation in Case |
4.46E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg06556827) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 2.57E-10; Z-score: -1.66E+01 | ||
|
Methylation in Case |
6.34E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg20475114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.57E+00 | Statistic Test | p-value: 1.20E-09; Z-score: -2.08E+01 | ||
|
Methylation in Case |
4.22E-01 (Median) | Methylation in Control | 6.63E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg07010687) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.98E+00 | Statistic Test | p-value: 2.52E-09; Z-score: -1.29E+01 | ||
|
Methylation in Case |
4.06E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg00502885) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.24E+00 | Statistic Test | p-value: 4.16E-09; Z-score: -1.51E+01 | ||
|
Methylation in Case |
3.48E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg05887366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.53E+00 | Statistic Test | p-value: 1.11E-08; Z-score: -1.33E+01 | ||
|
Methylation in Case |
4.35E-01 (Median) | Methylation in Control | 6.66E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg19619756) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.47E+00 | Statistic Test | p-value: 2.49E-08; Z-score: -1.00E+01 | ||
|
Methylation in Case |
3.58E-01 (Median) | Methylation in Control | 5.26E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg02580900) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 2.13E-07; Z-score: -9.05E+00 | ||
|
Methylation in Case |
4.80E-01 (Median) | Methylation in Control | 6.96E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg11666857) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.75E+00 | Statistic Test | p-value: 2.41E-07; Z-score: -5.74E+00 | ||
|
Methylation in Case |
3.66E-01 (Median) | Methylation in Control | 6.41E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg04135385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 7.40E-07; Z-score: -1.01E+01 | ||
|
Methylation in Case |
6.43E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg09648809) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 1.16E-06; Z-score: -5.87E+00 | ||
|
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg20706711) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.55E+00 | Statistic Test | p-value: 4.79E-06; Z-score: -6.39E+00 | ||
|
Methylation in Case |
4.04E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg05005358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 8.13E-06; Z-score: -4.65E+00 | ||
|
Methylation in Case |
5.81E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg23260105) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 2.57E-05; Z-score: -8.99E+00 | ||
|
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26537272) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 9.49E-05; Z-score: -1.14E+01 | ||
|
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 8.87E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg22165524) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 1.13E-04; Z-score: -8.02E+00 | ||
|
Methylation in Case |
7.62E-01 (Median) | Methylation in Control | 8.94E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg23119827) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 1.84E-04; Z-score: -4.27E+00 | ||
|
Methylation in Case |
5.99E-01 (Median) | Methylation in Control | 7.00E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg10800865) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 2.53E-04; Z-score: -8.88E+00 | ||
|
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 8.98E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg11842953) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.78E-04; Z-score: -8.23E+00 | ||
|
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg03807914) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 5.03E-04; Z-score: -4.27E+00 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg10979994) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 6.99E-04; Z-score: -7.11E+00 | ||
|
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg04553355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 7.32E-04; Z-score: -2.97E+00 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg16367697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.16E-03; Z-score: -6.62E+00 | ||
|
Methylation in Case |
7.27E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg04718185) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 1.45E-03; Z-score: -3.87E+00 | ||
|
Methylation in Case |
5.67E-01 (Median) | Methylation in Control | 7.11E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg15142890) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.47E-03; Z-score: -2.52E+00 | ||
|
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg06048662) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.58E-03; Z-score: -2.72E+00 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.57E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg06593603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 1.88E-03; Z-score: -3.80E+00 | ||
|
Methylation in Case |
2.96E-01 (Median) | Methylation in Control | 4.38E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg22632352) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 3.86E-03; Z-score: -4.78E+00 | ||
|
Methylation in Case |
5.45E-01 (Median) | Methylation in Control | 6.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg01840128) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.22E-02; Z-score: -8.18E-01 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg02327812) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.42E-02; Z-score: -5.71E-03 | ||
|
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg10035234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 4.35E-02; Z-score: 7.31E-02 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 45 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg18515046) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 7.77E-05; Z-score: -3.96E+00 | ||
|
Methylation in Case |
4.66E-01 (Median) | Methylation in Control | 5.60E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 46 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg26197930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 8.60E-05; Z-score: -3.39E+00 | ||
|
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 8.38E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 47 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg04248937) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.18E-02; Z-score: -2.69E+00 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 48 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg26498616) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.19E-02; Z-score: -1.19E+00 | ||
|
Methylation in Case |
8.41E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in depression | [ 5 ] | |||
|
Location |
TSS1500 (cg11123744) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 2.52E-02; Z-score: 6.90E-01 | ||
|
Methylation in Case |
6.69E-01 (Median) | Methylation in Control | 6.18E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in depression | [ 5 ] | |||
|
Location |
TSS200 (cg09837037) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 3.46E-02; Z-score: 3.73E-01 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in depression | [ 5 ] | |||
|
Location |
Body (cg24114651) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 4.21E-02; Z-score: 5.17E-01 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 7.82E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
30 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg26711638) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 5.93E-03; Z-score: -7.71E-01 | ||
|
Methylation in Case |
4.10E-01 (Median) | Methylation in Control | 4.75E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg26763542) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.63E+00 | Statistic Test | p-value: 2.55E-18; Z-score: -6.55E+00 | ||
|
Methylation in Case |
4.31E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg06517798) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 2.36E-14; Z-score: -8.74E+00 | ||
|
Methylation in Case |
5.93E-01 (Median) | Methylation in Control | 7.97E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg27056599) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.76E+00 | Statistic Test | p-value: 3.89E-12; Z-score: 7.14E+00 | ||
|
Methylation in Case |
3.32E-01 (Median) | Methylation in Control | 8.83E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg27619475) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 1.39E-11; Z-score: 1.70E+00 | ||
|
Methylation in Case |
5.64E-01 (Median) | Methylation in Control | 4.23E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg26948274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 5.39E-04; Z-score: -1.06E+00 | ||
|
Methylation in Case |
4.47E-01 (Median) | Methylation in Control | 5.17E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg02389859) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 8.51E-04; Z-score: -1.30E+00 | ||
|
Methylation in Case |
4.67E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg24266851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 7.48E-19; Z-score: -3.01E+00 | ||
|
Methylation in Case |
5.27E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg18948221) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 5.36E-14; Z-score: -4.97E+00 | ||
|
Methylation in Case |
5.80E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg14502431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 4.34E-12; Z-score: -8.31E+00 | ||
|
Methylation in Case |
7.14E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg16367697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 2.81E-08; Z-score: -1.26E+00 | ||
|
Methylation in Case |
6.53E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg20706711) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 3.78E-08; Z-score: -1.76E+00 | ||
|
Methylation in Case |
6.23E-01 (Median) | Methylation in Control | 7.19E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg22165524) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 3.98E-08; Z-score: -2.03E+00 | ||
|
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 8.83E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg00472281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 9.08E-08; Z-score: -2.22E+00 | ||
|
Methylation in Case |
5.81E-01 (Median) | Methylation in Control | 6.87E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg10035234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.08E-07; Z-score: -2.91E+00 | ||
|
Methylation in Case |
8.03E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg22632352) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 5.30E-07; Z-score: -1.32E+00 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 8.00E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg15142890) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.12E-06; Z-score: -2.32E+00 | ||
|
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg04553355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.35E-06; Z-score: -1.86E+00 | ||
|
Methylation in Case |
8.56E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg05887366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 2.26E-06; Z-score: -1.11E+00 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 7.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg04718185) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 3.89E-06; Z-score: -1.51E+00 | ||
|
Methylation in Case |
7.05E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg26537272) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 7.29E-05; Z-score: -8.78E-01 | ||
|
Methylation in Case |
8.35E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg12562822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.11E+00 | Statistic Test | p-value: 1.08E-04; Z-score: -5.45E-01 | ||
|
Methylation in Case |
1.35E-01 (Median) | Methylation in Control | 2.86E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg10800865) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.42E-04; Z-score: -8.47E-01 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg01840128) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.39E-03; Z-score: -3.09E-01 | ||
|
Methylation in Case |
8.43E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg24041118) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 4.49E-02; Z-score: 3.56E-01 | ||
|
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 7.21E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg12757078) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 1.98E-12; Z-score: -2.28E+00 | ||
|
Methylation in Case |
5.46E-01 (Median) | Methylation in Control | 7.93E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg26498616) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.20E-08; Z-score: -2.38E+00 | ||
|
Methylation in Case |
8.86E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg26197930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 5.48E-06; Z-score: -5.91E-01 | ||
|
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg22599115) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.14E-03; Z-score: -5.27E-01 | ||
|
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.42E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg04248937) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 7.16E-03; Z-score: -4.35E-01 | ||
|
Methylation in Case |
6.32E-01 (Median) | Methylation in Control | 6.93E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
15 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
TSS1500 (cg11123744) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.22E-02; Z-score: 3.86E-01 | ||
|
Methylation in Case |
7.08E-01 (Median) | Methylation in Control | 6.76E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
TSS200 (cg04309194) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 5.84E-03; Z-score: 7.18E-01 | ||
|
Methylation in Case |
8.56E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg10979994) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.64E-05; Z-score: 8.03E-01 | ||
|
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg20475114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.92E-04; Z-score: -1.36E+00 | ||
|
Methylation in Case |
6.57E-01 (Median) | Methylation in Control | 7.17E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg03807914) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 3.13E-04; Z-score: 7.89E-01 | ||
|
Methylation in Case |
8.84E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg10800865) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.44E-03; Z-score: 4.87E-01 | ||
|
Methylation in Case |
9.52E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg06048662) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.86E-03; Z-score: 4.11E-01 | ||
|
Methylation in Case |
9.73E-01 (Median) | Methylation in Control | 9.66E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg24041118) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 4.06E-03; Z-score: -1.12E+00 | ||
|
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg24114651) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 5.19E-03; Z-score: -7.30E-01 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg05972316) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 5.91E-03; Z-score: 1.03E+00 | ||
|
Methylation in Case |
2.21E-01 (Median) | Methylation in Control | 1.83E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg10035234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 9.79E-03; Z-score: 7.51E-01 | ||
|
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.21E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg09648809) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.01E-02; Z-score: 7.92E-01 | ||
|
Methylation in Case |
9.73E-01 (Median) | Methylation in Control | 9.59E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg06593603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.02E-02; Z-score: -4.75E-01 | ||
|
Methylation in Case |
4.32E-01 (Median) | Methylation in Control | 4.73E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg00472281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.15E-02; Z-score: -1.03E+00 | ||
|
Methylation in Case |
7.29E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg00502885) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.74E-02; Z-score: -3.22E-01 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
28 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg26711638) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.17E-02; Z-score: -4.86E-01 | ||
|
Methylation in Case |
2.58E-01 (Median) | Methylation in Control | 2.92E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg11123744) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.31E-02; Z-score: 3.03E-01 | ||
|
Methylation in Case |
2.77E-01 (Median) | Methylation in Control | 2.58E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
TSS200 (cg21492882) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 1.57E-03; Z-score: 1.04E+00 | ||
|
Methylation in Case |
4.94E-01 (Median) | Methylation in Control | 4.42E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
TSS200 (cg09837037) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 4.40E-03; Z-score: 1.37E+00 | ||
|
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 7.08E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg07010687) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 8.31E-15; Z-score: -3.15E+00 | ||
|
Methylation in Case |
7.65E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg24114651) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 9.14E-12; Z-score: -2.73E+00 | ||
|
Methylation in Case |
7.58E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg05005358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.48E-11; Z-score: -2.38E+00 | ||
|
Methylation in Case |
8.20E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg06556827) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 5.70E-11; Z-score: -3.39E+00 | ||
|
Methylation in Case |
8.42E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg00472281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 7.02E-11; Z-score: -1.90E+00 | ||
|
Methylation in Case |
6.71E-01 (Median) | Methylation in Control | 7.63E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg02580900) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 1.07E-09; Z-score: -1.86E+00 | ||
|
Methylation in Case |
7.23E-01 (Median) | Methylation in Control | 8.29E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg20475114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.71E-07; Z-score: -1.21E+00 | ||
|
Methylation in Case |
7.22E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg03807914) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.86E-06; Z-score: -1.16E+00 | ||
|
Methylation in Case |
8.63E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg04135385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.41E-05; Z-score: -1.16E+00 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg04553355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 5.38E-05; Z-score: -9.40E-01 | ||
|
Methylation in Case |
9.43E-01 (Median) | Methylation in Control | 9.57E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg06048662) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.41E-04; Z-score: -7.43E-01 | ||
|
Methylation in Case |
9.29E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg24041118) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 7.38E-04; Z-score: -2.83E-01 | ||
|
Methylation in Case |
7.07E-01 (Median) | Methylation in Control | 7.15E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg02685680) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 8.72E-04; Z-score: -5.49E-01 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 8.40E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg10979994) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 8.80E-04; Z-score: -6.59E-01 | ||
|
Methylation in Case |
8.60E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg09648809) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.27E-03; Z-score: -2.62E-01 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg05887366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.57E-03; Z-score: -4.70E-01 | ||
|
Methylation in Case |
7.03E-01 (Median) | Methylation in Control | 7.24E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg23119827) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.42E-03; Z-score: -3.86E-01 | ||
|
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 7.72E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg16367697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 6.41E-03; Z-score: -3.58E-01 | ||
|
Methylation in Case |
8.63E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg19619756) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 6.87E-03; Z-score: -5.02E-01 | ||
|
Methylation in Case |
5.58E-01 (Median) | Methylation in Control | 5.80E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg23000153) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.26E-02; Z-score: -4.54E-01 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg00502885) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.50E-02; Z-score: -2.94E-01 | ||
|
Methylation in Case |
7.77E-01 (Median) | Methylation in Control | 7.94E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg15142890) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.56E-02; Z-score: -3.35E-01 | ||
|
Methylation in Case |
9.39E-01 (Median) | Methylation in Control | 9.43E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
Body (cg10035234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.26E-02; Z-score: -7.59E-01 | ||
|
Methylation in Case |
9.12E-01 (Median) | Methylation in Control | 9.25E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
3'UTR (cg26197930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.39E-02; Z-score: -2.24E-01 | ||
|
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 9.05E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
27 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
TSS200 (cg09837037) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.47E-02; Z-score: -1.08E+00 | ||
|
Methylation in Case |
6.11E-01 (Median) | Methylation in Control | 6.87E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg20475114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 3.35E-14; Z-score: -2.70E+00 | ||
|
Methylation in Case |
5.00E-01 (Median) | Methylation in Control | 6.10E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg23119827) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 2.35E-13; Z-score: 2.18E+00 | ||
|
Methylation in Case |
7.05E-01 (Median) | Methylation in Control | 6.33E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg07010687) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 2.08E-11; Z-score: -2.56E+00 | ||
|
Methylation in Case |
5.37E-01 (Median) | Methylation in Control | 6.59E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg05972316) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 7.00E-11; Z-score: 1.92E+00 | ||
|
Methylation in Case |
1.95E-01 (Median) | Methylation in Control | 1.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg05005358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.62E-07; Z-score: -1.53E+00 | ||
|
Methylation in Case |
6.83E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg06593603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 1.94E-06; Z-score: -2.22E+00 | ||
|
Methylation in Case |
3.36E-01 (Median) | Methylation in Control | 4.34E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg19619756) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.97E-06; Z-score: -1.28E+00 | ||
|
Methylation in Case |
4.73E-01 (Median) | Methylation in Control | 5.16E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg02580900) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 2.12E-06; Z-score: -1.52E+00 | ||
|
Methylation in Case |
5.69E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg16367697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 4.81E-06; Z-score: -6.16E-01 | ||
|
Methylation in Case |
7.13E-01 (Median) | Methylation in Control | 7.32E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg10979994) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 4.82E-06; Z-score: -1.36E+00 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 8.30E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg06048662) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 8.45E-06; Z-score: -1.36E+00 | ||
|
Methylation in Case |
9.13E-01 (Median) | Methylation in Control | 9.46E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg24041118) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 1.66E-05; Z-score: -2.01E+00 | ||
|
Methylation in Case |
5.56E-01 (Median) | Methylation in Control | 6.63E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg09648809) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.28E-05; Z-score: -1.35E+00 | ||
|
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg03807914) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.13E-04; Z-score: -1.12E+00 | ||
|
Methylation in Case |
7.37E-01 (Median) | Methylation in Control | 7.98E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg04135385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.85E-04; Z-score: -1.11E+00 | ||
|
Methylation in Case |
7.52E-01 (Median) | Methylation in Control | 8.23E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg04553355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.97E-04; Z-score: -9.13E-01 | ||
|
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg23260105) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.10E-04; Z-score: -7.60E-01 | ||
|
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 9.10E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg02685680) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 4.25E-04; Z-score: -1.40E+00 | ||
|
Methylation in Case |
6.29E-01 (Median) | Methylation in Control | 6.76E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg11666857) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 6.11E-04; Z-score: -7.92E-01 | ||
|
Methylation in Case |
5.65E-01 (Median) | Methylation in Control | 6.05E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg00472281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.49E-03; Z-score: -1.03E+00 | ||
|
Methylation in Case |
5.01E-01 (Median) | Methylation in Control | 5.40E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg09517450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 3.27E-03; Z-score: -1.03E+00 | ||
|
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg10035234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 4.61E-03; Z-score: 4.84E-01 | ||
|
Methylation in Case |
8.42E-01 (Median) | Methylation in Control | 8.25E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg01840128) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.72E-03; Z-score: -1.58E-02 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg04718185) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.11E-02; Z-score: -4.69E-01 | ||
|
Methylation in Case |
6.79E-01 (Median) | Methylation in Control | 6.97E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg25582398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 3.89E-02; Z-score: -7.94E-01 | ||
|
Methylation in Case |
7.63E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
|
Location |
Body (cg11842953) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 4.49E-02; Z-score: -6.12E-01 | ||
|
Methylation in Case |
7.90E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
19 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg02389859) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 1.83E-05; Z-score: -2.83E+00 | ||
|
Methylation in Case |
5.31E-01 (Median) | Methylation in Control | 6.38E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg26948274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 6.93E-04; Z-score: -2.02E+00 | ||
|
Methylation in Case |
5.24E-01 (Median) | Methylation in Control | 5.96E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg21487099) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 3.66E-02; Z-score: -1.37E+00 | ||
|
Methylation in Case |
5.98E-01 (Median) | Methylation in Control | 6.59E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg01840128) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 9.12E-08; Z-score: 5.91E+00 | ||
|
Methylation in Case |
7.79E-01 (Median) | Methylation in Control | 5.91E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg04553355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.24E-06; Z-score: -1.54E+00 | ||
|
Methylation in Case |
9.68E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg07010687) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 2.00E-06; Z-score: -3.04E+00 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg04718185) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.23E+00 | Statistic Test | p-value: 3.35E-05; Z-score: 3.42E+00 | ||
|
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 6.64E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg23260105) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 1.20E-04; Z-score: 2.29E+00 | ||
|
Methylation in Case |
9.70E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg06556827) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.23E-04; Z-score: -1.04E+00 | ||
|
Methylation in Case |
9.27E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg20706711) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 1.57E-04; Z-score: 2.89E+00 | ||
|
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 6.05E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg22632352) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 3.21E-04; Z-score: 2.51E+00 | ||
|
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 8.41E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg11666857) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 1.30E-02; Z-score: 1.95E+00 | ||
|
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 6.50E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg02580900) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.71E-02; Z-score: -5.72E-01 | ||
|
Methylation in Case |
8.34E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg19619756) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.81E-02; Z-score: 9.47E-01 | ||
|
Methylation in Case |
5.88E-01 (Median) | Methylation in Control | 5.49E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg10979994) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.89E-02; Z-score: -6.80E-01 | ||
|
Methylation in Case |
8.91E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg06593603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 1.90E-02; Z-score: 1.55E+00 | ||
|
Methylation in Case |
4.74E-01 (Median) | Methylation in Control | 4.00E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg20475114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.13E-02; Z-score: -3.75E-01 | ||
|
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 7.56E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg00502885) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.12E-02; Z-score: -4.59E-01 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.52E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
|
Location |
Body (cg06048662) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.54E-02; Z-score: -4.52E-01 | ||
|
Methylation in Case |
9.74E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
33 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
TSS200 (cg26948274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 3.20E-02; Z-score: -8.23E-01 | ||
|
Methylation in Case |
5.56E-01 (Median) | Methylation in Control | 6.14E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg07010687) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 5.91E-14; Z-score: -6.61E+00 | ||
|
Methylation in Case |
7.52E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg20475114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 2.71E-13; Z-score: -4.51E+00 | ||
|
Methylation in Case |
7.24E-01 (Median) | Methylation in Control | 8.46E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg24114651) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 1.72E-12; Z-score: -5.76E+00 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg02580900) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 5.96E-11; Z-score: -3.70E+00 | ||
|
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg05005358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.49E-07; Z-score: -2.73E+00 | ||
|
Methylation in Case |
8.61E-01 (Median) | Methylation in Control | 9.09E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg23260105) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 6.41E-07; Z-score: -3.04E+00 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.74E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg10979994) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 8.22E-07; Z-score: -2.79E+00 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg05972316) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 1.13E-06; Z-score: 1.31E+00 | ||
|
Methylation in Case |
2.67E-01 (Median) | Methylation in Control | 2.23E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg11666857) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.65E-06; Z-score: -1.45E+00 | ||
|
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg10800865) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 7.30E-06; Z-score: -3.59E+00 | ||
|
Methylation in Case |
9.29E-01 (Median) | Methylation in Control | 9.52E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg06556827) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 9.25E-06; Z-score: -2.17E+00 | ||
|
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg05887366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.18E-05; Z-score: -7.57E-01 | ||
|
Methylation in Case |
8.50E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg06048662) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.92E-05; Z-score: -1.47E+00 | ||
|
Methylation in Case |
9.64E-01 (Median) | Methylation in Control | 9.73E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg06593603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.58E+00 | Statistic Test | p-value: 3.27E-05; Z-score: -1.15E+00 | ||
|
Methylation in Case |
2.93E-01 (Median) | Methylation in Control | 4.63E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg20706711) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 4.57E-05; Z-score: -1.64E+00 | ||
|
Methylation in Case |
7.68E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg16367697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.01E-04; Z-score: -1.62E+00 | ||
|
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg00502885) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.88E-04; Z-score: -7.09E-01 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg09648809) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.18E-04; Z-score: -8.92E-01 | ||
|
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.57E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg23119827) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.42E-03; Z-score: -7.83E-01 | ||
|
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg11842953) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.52E-03; Z-score: -7.01E-01 | ||
|
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg03807914) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.71E-03; Z-score: -5.44E-01 | ||
|
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg00472281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 5.70E-03; Z-score: -2.90E-01 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg12562822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.25E+00 | Statistic Test | p-value: 8.12E-03; Z-score: -6.56E-01 | ||
|
Methylation in Case |
9.41E-02 (Median) | Methylation in Control | 2.11E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg01840128) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.64E-02; Z-score: 1.25E+00 | ||
|
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 8.94E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg25582398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.73E-02; Z-score: -1.37E-01 | ||
|
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg23000153) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.68E-02; Z-score: 7.45E-01 | ||
|
Methylation in Case |
9.07E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg26537272) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.88E-02; Z-score: -3.14E-01 | ||
|
Methylation in Case |
9.36E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg24041118) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 4.24E-02; Z-score: -5.44E-01 | ||
|
Methylation in Case |
6.92E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
Body (cg15142890) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.36E-02; Z-score: -1.01E-01 | ||
|
Methylation in Case |
9.55E-01 (Median) | Methylation in Control | 9.55E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
3'UTR (cg22599115) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 6.78E-03; Z-score: -5.53E-01 | ||
|
Methylation in Case |
9.44E-01 (Median) | Methylation in Control | 9.51E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
3'UTR (cg04248937) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 8.31E-03; Z-score: 5.12E-01 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
|
Location |
3'UTR (cg26498616) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.40E-02; Z-score: -5.12E-01 | ||
|
Methylation in Case |
9.51E-01 (Median) | Methylation in Control | 9.61E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
TSS200 (cg02389859) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.76E-03; Z-score: -1.95E-01 | ||
|
Methylation in Case |
8.00E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
TSS200 (cg26948274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.30E-02; Z-score: -1.04E-01 | ||
|
Methylation in Case |
7.40E-01 (Median) | Methylation in Control | 7.45E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg11842953) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.04E-03; Z-score: -2.32E-01 | ||
|
Methylation in Case |
9.18E-01 (Median) | Methylation in Control | 9.22E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg02327812) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.26E-03; Z-score: -5.41E-02 | ||
|
Methylation in Case |
9.52E-01 (Median) | Methylation in Control | 9.54E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg02580900) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 5.81E-03; Z-score: -2.04E-01 | ||
|
Methylation in Case |
8.00E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg05005358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.33E-02; Z-score: -1.86E-01 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 8.80E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg02685680) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.62E-02; Z-score: -1.30E-01 | ||
|
Methylation in Case |
8.60E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg04553355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 2.34E-02; Z-score: -4.58E-02 | ||
|
Methylation in Case |
9.22E-01 (Median) | Methylation in Control | 9.23E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg04718185) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.00E-02; Z-score: -1.72E-01 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 8.88E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg20706711) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.24E-02; Z-score: -2.06E-01 | ||
|
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 8.07E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg06593603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 4.30E-02; Z-score: -1.77E-01 | ||
|
Methylation in Case |
2.83E-01 (Median) | Methylation in Control | 3.09E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
30 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg00472281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 2.67E-05; Z-score: 5.63E-01 | ||
|
Methylation in Case |
9.68E-02 (Median) | Methylation in Control | 8.93E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg00502885) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 2.75E-05; Z-score: -1.15E+00 | ||
|
Methylation in Case |
6.59E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg01840128) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.45E+00 | Statistic Test | p-value: 9.00E-05; Z-score: -1.48E+00 | ||
|
Methylation in Case |
2.18E-01 (Median) | Methylation in Control | 5.35E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg02327812) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 1.44E-04; Z-score: 5.90E-01 | ||
|
Methylation in Case |
2.63E-01 (Median) | Methylation in Control | 2.26E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg02580900) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 1.79E-04; Z-score: 1.02E+00 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 6.96E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg02685680) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 2.08E-04; Z-score: 5.64E-01 | ||
|
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 7.35E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg03807914) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 4.39E-04; Z-score: 1.16E+00 | ||
|
Methylation in Case |
8.10E-01 (Median) | Methylation in Control | 7.25E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg04135385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.81E+00 | Statistic Test | p-value: 5.65E-04; Z-score: -3.63E-01 | ||
|
Methylation in Case |
4.07E-02 (Median) | Methylation in Control | 1.14E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg04553355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 8.64E-04; Z-score: -6.87E-01 | ||
|
Methylation in Case |
7.10E-01 (Median) | Methylation in Control | 7.52E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg04718185) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 9.36E-04; Z-score: -9.30E-01 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 7.05E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg05005358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.48E+00 | Statistic Test | p-value: 1.17E-03; Z-score: -5.06E-01 | ||
|
Methylation in Case |
3.83E-02 (Median) | Methylation in Control | 9.47E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg05887366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 1.76E-03; Z-score: -7.26E-01 | ||
|
Methylation in Case |
4.70E-01 (Median) | Methylation in Control | 5.63E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg05972316) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.97E-03; Z-score: -4.84E-01 | ||
|
Methylation in Case |
8.95E-01 (Median) | Methylation in Control | 9.12E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg06048662) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 2.10E-03; Z-score: 1.21E+00 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 8.28E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg06556827) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.72E+00 | Statistic Test | p-value: 2.54E-03; Z-score: -6.85E-01 | ||
|
Methylation in Case |
5.75E-02 (Median) | Methylation in Control | 9.87E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg06593603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.65E-03; Z-score: -6.41E-01 | ||
|
Methylation in Case |
6.39E-01 (Median) | Methylation in Control | 6.60E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg07010687) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.48E+00 | Statistic Test | p-value: 3.23E-03; Z-score: 1.11E+00 | ||
|
Methylation in Case |
6.76E-01 (Median) | Methylation in Control | 4.57E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg09517450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.09E-02; Z-score: -5.49E-01 | ||
|
Methylation in Case |
9.61E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg09648809) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 1.15E-02; Z-score: 1.18E+00 | ||
|
Methylation in Case |
8.24E-01 (Median) | Methylation in Control | 7.04E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg10035234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.35E-02; Z-score: 4.26E-01 | ||
|
Methylation in Case |
8.09E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg10800865) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 1.82E-02; Z-score: -8.16E-01 | ||
|
Methylation in Case |
2.03E-01 (Median) | Methylation in Control | 2.60E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg10979994) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.96E-02; Z-score: -2.59E-01 | ||
|
Methylation in Case |
9.59E-01 (Median) | Methylation in Control | 9.64E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg11666857) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 2.40E-02; Z-score: 4.19E-01 | ||
|
Methylation in Case |
9.40E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg11842953) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.54E-02; Z-score: -2.72E-01 | ||
|
Methylation in Case |
9.17E-01 (Median) | Methylation in Control | 9.23E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg12562822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 2.81E-02; Z-score: -7.14E-01 | ||
|
Methylation in Case |
1.58E-01 (Median) | Methylation in Control | 2.06E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
3'UTR (cg04248937) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.44E+00 | Statistic Test | p-value: 2.75E-14; Z-score: -2.26E+00 | ||
|
Methylation in Case |
5.19E-01 (Median) | Methylation in Control | 7.49E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
3'UTR (cg18515046) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.46E+00 | Statistic Test | p-value: 1.67E-10; Z-score: 1.74E+00 | ||
|
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 5.71E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
3'UTR (cg22599115) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 6.15E-10; Z-score: -1.89E+00 | ||
|
Methylation in Case |
6.35E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
3'UTR (cg26197930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 2.73E-09; Z-score: -1.58E+00 | ||
|
Methylation in Case |
6.91E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
3'UTR (cg26498616) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 2.79E-09; Z-score: -1.48E+00 | ||
|
Methylation in Case |
4.79E-01 (Median) | Methylation in Control | 5.88E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg20706711) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 4.07E-04; Z-score: 2.59E+00 | ||
|
Methylation in Case |
7.02E-01 (Median) | Methylation in Control | 6.12E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg23260105) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.02E-03; Z-score: 2.21E+00 | ||
|
Methylation in Case |
9.57E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg05972316) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 3.12E-03; Z-score: 2.67E+00 | ||
|
Methylation in Case |
2.72E-01 (Median) | Methylation in Control | 2.16E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg00472281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 3.98E-03; Z-score: -2.99E+00 | ||
|
Methylation in Case |
6.48E-01 (Median) | Methylation in Control | 7.28E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg06593603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 1.30E-02; Z-score: -2.69E+00 | ||
|
Methylation in Case |
4.42E-01 (Median) | Methylation in Control | 5.10E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg04718185) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 1.49E-02; Z-score: 1.65E+00 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 6.75E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg09517450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.38E-02; Z-score: -2.99E+00 | ||
|
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg23119827) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 2.55E-02; Z-score: 1.42E+00 | ||
|
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 7.52E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg24041118) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.60E-02; Z-score: -1.39E+00 | ||
|
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg06048662) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.92E-02; Z-score: -3.38E+00 | ||
|
Methylation in Case |
9.34E-01 (Median) | Methylation in Control | 9.58E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC6A19 in panic disorder | [ 15 ] | |||
|
Location |
Body (cg04718185) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 3.90E-02; Z-score: 6.32E-01 | ||
|
Methylation in Case |
2.17E+00 (Median) | Methylation in Control | 1.84E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Cerebral hemispheric glioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC6A19 in cerebral hemispheric glioma than that in healthy individual | ||||
Studied Phenotype |
Cerebral hemispheric glioma [ICD-11:2A00.5] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000854171; Fold-change: -0.216387134; Z-score: -1.623304533 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Melanoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC6A19 in melanoma than that in healthy individual | ||||
Studied Phenotype |
Melanoma [ICD-11:2C30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.63E-08; Fold-change: -0.277675735; Z-score: -1.358559569 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Meningioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC6A19 in meningioma than that in healthy individual | ||||
Studied Phenotype |
Meningioma [ICD-11:2A01.0Z] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 5.81E-46; Fold-change: -0.282843082; Z-score: -1.933108385 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Obesity |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC6A19 in obesity than that in healthy individual | ||||
Studied Phenotype |
Obesity [ICD-11:5B81] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 5.03E-22; Fold-change: -0.271383868; Z-score: -2.992487729 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Posterior fossa ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC6A19 in posterior fossa ependymoma than that in healthy individual | ||||
Studied Phenotype |
Posterior fossa ependymoma [ICD-11:2D50.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 5.40E-38; Fold-change: -0.208886065; Z-score: -1.451747797 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC6A19 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.00054778; Fold-change: -0.235713843; Z-score: -4.332870262 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Chordoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC6A19 in chordoma than that in healthy individual | ||||
Studied Phenotype |
Chordoma [ICD-11:5A61.0] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.73E-06; Fold-change: -0.314265195; Z-score: -2.852475021 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Glioblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC6A19 in glioblastoma than that in healthy individual | ||||
Studied Phenotype |
Glioblastoma [ICD-11:2A00.00] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000538429; Fold-change: -0.304023798; Z-score: -1.169439521 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Peripheral neuroectodermal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC6A19 in peripheral neuroectodermal tumour than that in healthy individual | ||||
Studied Phenotype |
Peripheral neuroectodermal tumour [ICD-11:2B52] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.002971332; Fold-change: -0.367568005; Z-score: -1.497377123 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Liver cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC6A19 in liver cancer than that in adjacent tissue | ||||
Studied Phenotype |
Liver cancer [ICD-11:2C12] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value: 2.01E-09; Fold-change: -0.214670476; Z-score: -2.594277616 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
microRNA |
|||||
|
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-148b directly targets SLC6A19 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-148b | miRNA Mature ID | miR-148b-3p | ||
|
miRNA Sequence |
UCAGUGCAUCACAGAACUUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.