Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0458 Transporter Info
Gene Name SLC6A6
Transporter Name Sodium- and chloride-dependent taurine transporter
Gene ID
6533
UniProt ID
P31641
Epigenetic Regulations of This DT (EGR)

microRNA

  Multiple system atrophy

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Higher expression of miR-124 in multiple system atrophy [ 1 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

 Down regulation of SLC6A6 Experiment Method Immunohistochemical staining

miRNA Stemloop ID

 miR-96 miRNA Mature ID Unclear

miRNA Target Type

 Direct

Studied Phenotype

 Multiple system atrophy [ ICD-11: 8D87.0]

Experimental Material

 Patient tissue samples

Additional Notes

 miR-96 downregulates SLC6A6 in multiple system atrophy, and its dysregulation may play a role in MSA.

  Unclear Phenotype

          27 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-105 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-105 miRNA Mature ID miR-105-5p

miRNA Sequence

 UCAAAUGCUCAGACUCCUGUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-134 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-134 miRNA Mature ID miR-134-5p

miRNA Sequence

 UGUGACUGGUUGACCAGAGGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-151a directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-151a miRNA Mature ID miR-151a-3p

miRNA Sequence

 CUAGACUGAAGCUCCUUGAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-186 directly targets SLC6A6 [ 3 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-186 miRNA Mature ID miR-186-5p

miRNA Sequence

 CAAAGAAUUCUCCUUUUGGGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-23a directly targets SLC6A6 [ 3 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-23a miRNA Mature ID miR-23a-3p

miRNA Sequence

 AUCACAUUGCCAGGGAUUUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-27b directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-27b miRNA Mature ID miR-27b-5p

miRNA Sequence

 AGAGCUUAGCUGAUUGGUGAAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-3118 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3118 miRNA Mature ID miR-3118

miRNA Sequence

 UGUGACUGCAUUAUGAAAAUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-329 directly targets SLC6A6 [ 4 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

 AACACACCUGGUUAACCUCUUU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 9

 miR-335 directly targets SLC6A6 [ 5 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-362 directly targets SLC6A6 [ 4 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

 AACACACCUAUUCAAGGAUUCA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 11

 miR-3671 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3671 miRNA Mature ID miR-3671

miRNA Sequence

 AUCAAAUAAGGACUAGUCUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-3941 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

 UUACACACAACUGAGGAUCAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-423 directly targets SLC6A6 [ 3 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-423 miRNA Mature ID miR-423-5p

miRNA Sequence

 UGAGGGGCAGAGAGCGAGACUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 14

 miR-4453 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4453 miRNA Mature ID miR-4453

miRNA Sequence

 GAGCUUGGUCUGUAGCGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-4499 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4499 miRNA Mature ID miR-4499

miRNA Sequence

 AAGACUGAGAGGAGGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-4538 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4538 miRNA Mature ID miR-4538

miRNA Sequence

 GAGCUUGGAUGAGCUGGGCUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-4789 directly targets SLC6A6 [ 4 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4789 miRNA Mature ID miR-4789-3p

miRNA Sequence

 CACACAUAGCAGGUGUAUAUA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 18

 miR-5197 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5197 miRNA Mature ID miR-5197-5p

miRNA Sequence

 CAAUGGCACAAACUCAUUCUUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-548as directly targets SLC6A6 [ 6 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548as miRNA Mature ID miR-548as-3p

miRNA Sequence

 UAAAACCCACAAUUAUGUUUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 20

 miR-603 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-603 miRNA Mature ID miR-603

miRNA Sequence

 CACACACUGCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-607 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-607 miRNA Mature ID miR-607

miRNA Sequence

 GUUCAAAUCCAGAUCUAUAAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-6079 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6079 miRNA Mature ID miR-6079

miRNA Sequence

 UUGGAAGCUUGGACCAACUAGCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-6857 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6857 miRNA Mature ID miR-6857-3p

miRNA Sequence

 UGACUGAGCUUCUCCCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-7853 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7853 miRNA Mature ID miR-7853-5p

miRNA Sequence

 UCAAAUGCAGAUCCUGACUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-8485 directly targets SLC6A6 [ 4 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

 CACACACACACACACACGUAU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 26

 miR-943 directly targets SLC6A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-943 miRNA Mature ID miR-943

miRNA Sequence

 CUGACUGUUGCCGUCCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-96 directly targets SLC6A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method Immunohistochemistry//Luciferase reporter assay//qRT-PCR

miRNA Stemloop ID

 miR-96 miRNA Mature ID miR-96-5p

miRNA Sequence

 UUUGGCACUAGCACAUUUUUGCU

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

Methylation

  Atypical teratoid rhabdoid tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypermethylation of SLC6A6 in atypical teratoid rhabdoid tumour than that in healthy individual

Studied Phenotype

 Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 4.68E-13; Fold-change: 0.404310858; Z-score: 1.839153423
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual
References
1 Widespread microRNA dysregulation in multiple system atrophy - disease-related alteration in miR-96. Eur J Neurosci. 2014 Mar;39(6):1026-41.
2 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
3 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
4 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
5 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
6 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.