Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0460 Transporter Info | ||||
Gene Name | SLC6A8 | ||||
Transporter Name | Creatine transporter 1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
59 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-1256 directly targets SLC6A8 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1256 | miRNA Mature ID | miR-1256 | ||
miRNA Sequence |
AGGCAUUGACUUCUCACUAGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 2 |
miR-1468 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1468 | miRNA Mature ID | miR-1468-3p | ||
miRNA Sequence |
AGCAAAAUAAGCAAAUGGAAAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 3 |
miR-1587 directly targets SLC6A8 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1587 | miRNA Mature ID | miR-1587 | ||
miRNA Sequence |
UUGGGCUGGGCUGGGUUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 4 |
miR-190a directly targets SLC6A8 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-190a | miRNA Mature ID | miR-190a-3p | ||
miRNA Sequence |
CUAUAUAUCAAACAUAUUCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 5 |
miR-196a directly targets SLC6A8 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-196a | miRNA Mature ID | miR-196a-5p | ||
miRNA Sequence |
UAGGUAGUUUCAUGUUGUUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 6 |
miR-19a directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-19a | miRNA Mature ID | miR-19a-3p | ||
miRNA Sequence |
UGUGCAAAUCUAUGCAAAACUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 7 |
miR-19b directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-19b | miRNA Mature ID | miR-19b-3p | ||
miRNA Sequence |
UGUGCAAAUCCAUGCAAAACUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 8 |
miR-300 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-300 | miRNA Mature ID | miR-300 | ||
miRNA Sequence |
UAUACAAGGGCAGACUCUCUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 9 |
miR-3121 directly targets SLC6A8 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3121 | miRNA Mature ID | miR-3121-5p | ||
miRNA Sequence |
UCCUUUGCCUAUUCUAUUUAAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 10 |
miR-3126 directly targets SLC6A8 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3126 | miRNA Mature ID | miR-3126-3p | ||
miRNA Sequence |
CAUCUGGCAUCCGUCACACAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-3128 directly targets SLC6A8 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3128 | miRNA Mature ID | miR-3128 | ||
miRNA Sequence |
UCUGGCAAGUAAAAAACUCUCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 12 |
miR-3148 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3148 | miRNA Mature ID | miR-3148 | ||
miRNA Sequence |
UGGAAAAAACUGGUGUGUGCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 13 |
miR-3163 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3163 | miRNA Mature ID | miR-3163 | ||
miRNA Sequence |
UAUAAAAUGAGGGCAGUAAGAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 14 |
miR-3174 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3174 | miRNA Mature ID | miR-3174 | ||
miRNA Sequence |
UAGUGAGUUAGAGAUGCAGAGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 15 |
miR-340 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-340 | miRNA Mature ID | miR-340-5p | ||
miRNA Sequence |
UUAUAAAGCAAUGAGACUGAUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 16 |
miR-3606 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3606 | miRNA Mature ID | miR-3606-5p | ||
miRNA Sequence |
UUAGUGAAGGCUAUUUUAAUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 17 |
miR-3620 directly targets SLC6A8 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3620 | miRNA Mature ID | miR-3620-5p | ||
miRNA Sequence |
GUGGGCUGGGCUGGGCUGGGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 18 |
miR-3662 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3662 | miRNA Mature ID | miR-3662 | ||
miRNA Sequence |
GAAAAUGAUGAGUAGUGACUGAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 19 |
miR-3663 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3663 | miRNA Mature ID | miR-3663-3p | ||
miRNA Sequence |
UGAGCACCACACAGGCCGGGCGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 20 |
miR-3688 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3688 | miRNA Mature ID | miR-3688-3p | ||
miRNA Sequence |
UAUGGAAAGACUUUGCCACUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 21 |
miR-381 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-381 | miRNA Mature ID | miR-381-3p | ||
miRNA Sequence |
UAUACAAGGGCAAGCUCUCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 22 |
miR-382 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-382 | miRNA Mature ID | miR-382-5p | ||
miRNA Sequence |
GAAGUUGUUCGUGGUGGAUUCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 23 |
miR-3976 directly targets SLC6A8 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3976 | miRNA Mature ID | miR-3976 | ||
miRNA Sequence |
UAUAGAGAGCAGGAAGAUUAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 24 |
miR-4437 directly targets SLC6A8 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4437 | miRNA Mature ID | miR-4437 | ||
miRNA Sequence |
UGGGCUCAGGGUACAAAGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 25 |
miR-4448 directly targets SLC6A8 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4448 | miRNA Mature ID | miR-4448 | ||
miRNA Sequence |
GGCUCCUUGGUCUAGGGGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 26 |
miR-4477a directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4477a | miRNA Mature ID | miR-4477a | ||
miRNA Sequence |
CUAUUAAGGACAUUUGUGAUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 27 |
miR-4639 directly targets SLC6A8 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4639 | miRNA Mature ID | miR-4639-5p | ||
miRNA Sequence |
UUGCUAAGUAGGCUGAGAUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 28 |
miR-4674 directly targets SLC6A8 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4674 | miRNA Mature ID | miR-4674 | ||
miRNA Sequence |
CUGGGCUCGGGACGCGCGGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 29 |
miR-4694 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4694 | miRNA Mature ID | miR-4694-3p | ||
miRNA Sequence |
CAAAUGGACAGGAUAACACCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 30 |
miR-4720 directly targets SLC6A8 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4720 | miRNA Mature ID | miR-4720-5p | ||
miRNA Sequence |
CCUGGCAUAUUUGGUAUAACUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 31 |
miR-4768 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4768 | miRNA Mature ID | miR-4768-5p | ||
miRNA Sequence |
AUUCUCUCUGGAUCCCAUGGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 32 |
miR-4799 directly targets SLC6A8 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4799 | miRNA Mature ID | miR-4799-3p | ||
miRNA Sequence |
ACUGGCAUGCUGCAUUUAUAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 33 |
miR-484 directly targets SLC6A8 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-484 | miRNA Mature ID | miR-484 | ||
miRNA Sequence |
UCAGGCUCAGUCCCCUCCCGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 34 |
miR-5011 directly targets SLC6A8 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5011 | miRNA Mature ID | miR-5011-5p | ||
miRNA Sequence |
UAUAUAUACAGCCAUGCACUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 35 |
miR-513c directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-513c | miRNA Mature ID | miR-513c-5p | ||
miRNA Sequence |
UUCUCAAGGAGGUGUCGUUUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 36 |
miR-514b directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-514b | miRNA Mature ID | miR-514b-5p | ||
miRNA Sequence |
UUCUCAAGAGGGAGGCAAUCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 37 |
miR-548aj directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548aj | miRNA Mature ID | miR-548aj-5p | ||
miRNA Sequence |
UGCAAAAGUAAUUGCAGUUUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 38 |
miR-548aw directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548aw | miRNA Mature ID | miR-548aw | ||
miRNA Sequence |
GUGCAAAAGUCAUCACGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 39 |
miR-548c directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548c | miRNA Mature ID | miR-548c-3p | ||
miRNA Sequence |
CAAAAAUCUCAAUUACUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 40 |
miR-548f directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548f | miRNA Mature ID | miR-548f-5p | ||
miRNA Sequence |
UGCAAAAGUAAUCACAGUUUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 41 |
miR-548g directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548g | miRNA Mature ID | miR-548g-5p | ||
miRNA Sequence |
UGCAAAAGUAAUUGCAGUUUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 42 |
miR-548x directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548x | miRNA Mature ID | miR-548x-5p | ||
miRNA Sequence |
UGCAAAAGUAAUUGCAGUUUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 43 |
miR-5588 directly targets SLC6A8 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5588 | miRNA Mature ID | miR-5588-5p | ||
miRNA Sequence |
ACUGGCAUUAGUGGGACUUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 44 |
miR-5680 directly targets SLC6A8 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5680 | miRNA Mature ID | miR-5680 | ||
miRNA Sequence |
GAGAAAUGCUGGACUAAUCUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 45 |
miR-6124 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6124 | miRNA Mature ID | miR-6124 | ||
miRNA Sequence |
GGGAAAAGGAAGGGGGAGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 46 |
miR-6740 directly targets SLC6A8 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6740 | miRNA Mature ID | miR-6740-5p | ||
miRNA Sequence |
AGUUUGGGAUGGAGAGAGGAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 47 |
miR-6780a directly targets SLC6A8 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6780a | miRNA Mature ID | miR-6780a-3p | ||
miRNA Sequence |
CUCCUCUGUUUUCUUUCCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 48 |
miR-6782 directly targets SLC6A8 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6782 | miRNA Mature ID | miR-6782-3p | ||
miRNA Sequence |
CACCUUUGUGUCCCCAUCCUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 49 |
miR-6791 directly targets SLC6A8 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6791 | miRNA Mature ID | miR-6791-3p | ||
miRNA Sequence |
UGCCUCCUUGGUCUCCGGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 50 |
miR-6829 directly targets SLC6A8 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6829 | miRNA Mature ID | miR-6829-3p | ||
miRNA Sequence |
UGCCUCCUCCGUGGCCUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 51 |
miR-6833 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6833 | miRNA Mature ID | miR-6833-3p | ||
miRNA Sequence |
UUUCUCUCUCCACUUCCUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 52 |
miR-6868 directly targets SLC6A8 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6868 | miRNA Mature ID | miR-6868-5p | ||
miRNA Sequence |
ACUGGCAGAACACUGAAGCAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 53 |
miR-6873 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6873 | miRNA Mature ID | miR-6873-3p | ||
miRNA Sequence |
UUCUCUCUGUCUUUCUCUCUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 54 |
miR-6881 directly targets SLC6A8 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6881 | miRNA Mature ID | miR-6881-3p | ||
miRNA Sequence |
AUCCUCUUUCGUCCUUCCCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 55 |
miR-7109 directly targets SLC6A8 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7109 | miRNA Mature ID | miR-7109-3p | ||
miRNA Sequence |
CAAGCCUCUCCUGCCCUUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 56 |
miR-7111 directly targets SLC6A8 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7111 | miRNA Mature ID | miR-7111-3p | ||
miRNA Sequence |
AUCCUCUCUUCCCUCCUCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 57 |
miR-877 directly targets SLC6A8 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-877 | miRNA Mature ID | miR-877-3p | ||
miRNA Sequence |
UCCUCUUCUCCCUCCUCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 58 |
miR-921 directly targets SLC6A8 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-921 | miRNA Mature ID | miR-921 | ||
miRNA Sequence |
CUAGUGAGGGACAGAACCAGGAUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 59 |
miR-92a directly targets SLC6A8 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-92a | miRNA Mature ID | miR-92a-3p | ||
miRNA Sequence |
UAUUGCACUUGUCCCGGCCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Methylation |
|||||
Peripheral neuroectodermal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC6A8 in peripheral neuroectodermal tumour than that in healthy individual | ||||
Studied Phenotype |
Peripheral neuroectodermal tumour [ICD-11:2B52] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.85E-11; Fold-change: 0.238781566; Z-score: 2.447943674 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Arterial aneurysm |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC6A8 in arterial aneurysm than that in healthy individual | ||||
Studied Phenotype |
Arterial aneurysm [ICD-11:BD51] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.002655329; Fold-change: 0.348956457; Z-score: 3.249963645 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
Esthesioneuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC6A8 in esthesioneuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Esthesioneuroblastoma [ICD-11:2D50.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.94E-08; Fold-change: -0.374853296; Z-score: -1.710630173 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Lung cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC6A8 in lung cancer than that in adjacent tissue | ||||
Studied Phenotype |
Lung cancer [ICD-11:2C25] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value: 1.12E-13; Fold-change: -0.292862214; Z-score: -7.40202544 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.