Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0460 Transporter Info
Gene Name SLC6A8
Transporter Name Creatine transporter 1
Gene ID
6535
UniProt ID
P48029
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

          59 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1256 directly targets SLC6A8 [ 1 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1256 miRNA Mature ID miR-1256

miRNA Sequence

 AGGCAUUGACUUCUCACUAGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-1468 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1468 miRNA Mature ID miR-1468-3p

miRNA Sequence

 AGCAAAAUAAGCAAAUGGAAAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-1587 directly targets SLC6A8 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1587 miRNA Mature ID miR-1587

miRNA Sequence

 UUGGGCUGGGCUGGGUUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-190a directly targets SLC6A8 [ 1 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-190a miRNA Mature ID miR-190a-3p

miRNA Sequence

 CUAUAUAUCAAACAUAUUCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-196a directly targets SLC6A8 [ 4 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-196a miRNA Mature ID miR-196a-5p

miRNA Sequence

 UAGGUAGUUUCAUGUUGUUGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-19a directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19a miRNA Mature ID miR-19a-3p

miRNA Sequence

 UGUGCAAAUCUAUGCAAAACUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-19b directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

 UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-300 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-300 miRNA Mature ID miR-300

miRNA Sequence

 UAUACAAGGGCAGACUCUCUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-3121 directly targets SLC6A8 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3121 miRNA Mature ID miR-3121-5p

miRNA Sequence

 UCCUUUGCCUAUUCUAUUUAAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-3126 directly targets SLC6A8 [ 1 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3126 miRNA Mature ID miR-3126-3p

miRNA Sequence

 CAUCUGGCAUCCGUCACACAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-3128 directly targets SLC6A8 [ 1 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3128 miRNA Mature ID miR-3128

miRNA Sequence

 UCUGGCAAGUAAAAAACUCUCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-3148 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3148 miRNA Mature ID miR-3148

miRNA Sequence

 UGGAAAAAACUGGUGUGUGCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-3163 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3163 miRNA Mature ID miR-3163

miRNA Sequence

 UAUAAAAUGAGGGCAGUAAGAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 14

 miR-3174 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3174 miRNA Mature ID miR-3174

miRNA Sequence

 UAGUGAGUUAGAGAUGCAGAGCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-340 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-340 miRNA Mature ID miR-340-5p

miRNA Sequence

 UUAUAAAGCAAUGAGACUGAUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-3606 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3606 miRNA Mature ID miR-3606-5p

miRNA Sequence

 UUAGUGAAGGCUAUUUUAAUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-3620 directly targets SLC6A8 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3620 miRNA Mature ID miR-3620-5p

miRNA Sequence

 GUGGGCUGGGCUGGGCUGGGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-3662 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3662 miRNA Mature ID miR-3662

miRNA Sequence

 GAAAAUGAUGAGUAGUGACUGAUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 19

 miR-3663 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3663 miRNA Mature ID miR-3663-3p

miRNA Sequence

 UGAGCACCACACAGGCCGGGCGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 20

 miR-3688 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3688 miRNA Mature ID miR-3688-3p

miRNA Sequence

 UAUGGAAAGACUUUGCCACUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 21

 miR-381 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-381 miRNA Mature ID miR-381-3p

miRNA Sequence

 UAUACAAGGGCAAGCUCUCUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

 miR-382 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-382 miRNA Mature ID miR-382-5p

miRNA Sequence

 GAAGUUGUUCGUGGUGGAUUCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 23

 miR-3976 directly targets SLC6A8 [ 1 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3976 miRNA Mature ID miR-3976

miRNA Sequence

 UAUAGAGAGCAGGAAGAUUAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-4437 directly targets SLC6A8 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4437 miRNA Mature ID miR-4437

miRNA Sequence

 UGGGCUCAGGGUACAAAGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-4448 directly targets SLC6A8 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4448 miRNA Mature ID miR-4448

miRNA Sequence

 GGCUCCUUGGUCUAGGGGUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-4477a directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4477a miRNA Mature ID miR-4477a

miRNA Sequence

 CUAUUAAGGACAUUUGUGAUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 27

 miR-4639 directly targets SLC6A8 [ 1 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4639 miRNA Mature ID miR-4639-5p

miRNA Sequence

 UUGCUAAGUAGGCUGAGAUUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-4674 directly targets SLC6A8 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4674 miRNA Mature ID miR-4674

miRNA Sequence

 CUGGGCUCGGGACGCGCGGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-4694 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4694 miRNA Mature ID miR-4694-3p

miRNA Sequence

 CAAAUGGACAGGAUAACACCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 30

 miR-4720 directly targets SLC6A8 [ 1 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4720 miRNA Mature ID miR-4720-5p

miRNA Sequence

 CCUGGCAUAUUUGGUAUAACUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-4768 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4768 miRNA Mature ID miR-4768-5p

miRNA Sequence

 AUUCUCUCUGGAUCCCAUGGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 32

 miR-4799 directly targets SLC6A8 [ 1 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4799 miRNA Mature ID miR-4799-3p

miRNA Sequence

 ACUGGCAUGCUGCAUUUAUAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-484 directly targets SLC6A8 [ 4 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-484 miRNA Mature ID miR-484

miRNA Sequence

 UCAGGCUCAGUCCCCUCCCGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 34

 miR-5011 directly targets SLC6A8 [ 1 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5011 miRNA Mature ID miR-5011-5p

miRNA Sequence

 UAUAUAUACAGCCAUGCACUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-513c directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-513c miRNA Mature ID miR-513c-5p

miRNA Sequence

 UUCUCAAGGAGGUGUCGUUUAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 36

 miR-514b directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-514b miRNA Mature ID miR-514b-5p

miRNA Sequence

 UUCUCAAGAGGGAGGCAAUCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 37

 miR-548aj directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548aj miRNA Mature ID miR-548aj-5p

miRNA Sequence

 UGCAAAAGUAAUUGCAGUUUUUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 38

 miR-548aw directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548aw miRNA Mature ID miR-548aw

miRNA Sequence

 GUGCAAAAGUCAUCACGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 39

 miR-548c directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548c miRNA Mature ID miR-548c-3p

miRNA Sequence

 CAAAAAUCUCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 40

 miR-548f directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548f miRNA Mature ID miR-548f-5p

miRNA Sequence

 UGCAAAAGUAAUCACAGUUUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 41

 miR-548g directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548g miRNA Mature ID miR-548g-5p

miRNA Sequence

 UGCAAAAGUAAUUGCAGUUUUUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 42

 miR-548x directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548x miRNA Mature ID miR-548x-5p

miRNA Sequence

 UGCAAAAGUAAUUGCAGUUUUUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 43

 miR-5588 directly targets SLC6A8 [ 1 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5588 miRNA Mature ID miR-5588-5p

miRNA Sequence

 ACUGGCAUUAGUGGGACUUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 44

 miR-5680 directly targets SLC6A8 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5680 miRNA Mature ID miR-5680

miRNA Sequence

 GAGAAAUGCUGGACUAAUCUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 45

 miR-6124 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6124 miRNA Mature ID miR-6124

miRNA Sequence

 GGGAAAAGGAAGGGGGAGGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 46

 miR-6740 directly targets SLC6A8 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6740 miRNA Mature ID miR-6740-5p

miRNA Sequence

 AGUUUGGGAUGGAGAGAGGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 47

 miR-6780a directly targets SLC6A8 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6780a miRNA Mature ID miR-6780a-3p

miRNA Sequence

 CUCCUCUGUUUUCUUUCCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 48

 miR-6782 directly targets SLC6A8 [ 1 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6782 miRNA Mature ID miR-6782-3p

miRNA Sequence

 CACCUUUGUGUCCCCAUCCUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 49

 miR-6791 directly targets SLC6A8 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6791 miRNA Mature ID miR-6791-3p

miRNA Sequence

 UGCCUCCUUGGUCUCCGGCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 50

 miR-6829 directly targets SLC6A8 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6829 miRNA Mature ID miR-6829-3p

miRNA Sequence

 UGCCUCCUCCGUGGCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 51

 miR-6833 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6833 miRNA Mature ID miR-6833-3p

miRNA Sequence

 UUUCUCUCUCCACUUCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 52

 miR-6868 directly targets SLC6A8 [ 1 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6868 miRNA Mature ID miR-6868-5p

miRNA Sequence

 ACUGGCAGAACACUGAAGCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 53

 miR-6873 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6873 miRNA Mature ID miR-6873-3p

miRNA Sequence

 UUCUCUCUGUCUUUCUCUCUCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 54

 miR-6881 directly targets SLC6A8 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6881 miRNA Mature ID miR-6881-3p

miRNA Sequence

 AUCCUCUUUCGUCCUUCCCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 55

 miR-7109 directly targets SLC6A8 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7109 miRNA Mature ID miR-7109-3p

miRNA Sequence

 CAAGCCUCUCCUGCCCUUCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 56

 miR-7111 directly targets SLC6A8 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7111 miRNA Mature ID miR-7111-3p

miRNA Sequence

 AUCCUCUCUUCCCUCCUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 57

 miR-877 directly targets SLC6A8 [ 3 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-877 miRNA Mature ID miR-877-3p

miRNA Sequence

 UCCUCUUCUCCCUCCUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 58

 miR-921 directly targets SLC6A8 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-921 miRNA Mature ID miR-921

miRNA Sequence

 CUAGUGAGGGACAGAACCAGGAUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 59

 miR-92a directly targets SLC6A8 [ 4 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-92a miRNA Mature ID miR-92a-3p

miRNA Sequence

 UAUUGCACUUGUCCCGGCCUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

Methylation

  Peripheral neuroectodermal tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypermethylation of SLC6A8 in peripheral neuroectodermal tumour than that in healthy individual

Studied Phenotype

 Peripheral neuroectodermal tumour [ICD-11:2B52]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.85E-11; Fold-change: 0.238781566; Z-score: 2.447943674
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Arterial aneurysm

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypermethylation of SLC6A8 in arterial aneurysm than that in healthy individual

Studied Phenotype

 Arterial aneurysm [ICD-11:BD51]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.002655329; Fold-change: 0.348956457; Z-score: 3.249963645
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section
Download DT methylation data in the tissue of healthy individual

  Esthesioneuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC6A8 in esthesioneuroblastoma than that in healthy individual

Studied Phenotype

 Esthesioneuroblastoma [ICD-11:2D50.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 3.94E-08; Fold-change: -0.374853296; Z-score: -1.710630173
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Lung cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC6A8 in lung cancer than that in adjacent tissue

Studied Phenotype

 Lung cancer [ICD-11:2C25]

The Methylation Level of Disease Section Compare with the Adjacent Tissue

 p-value: 1.12E-13; Fold-change: -0.292862214; Z-score: -7.40202544
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual
Download DT methylation data in the tissue of the other disease section
References
1 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
2 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
3 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
4 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
5 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.