Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0461 Transporter Info
Gene Name SLC6A9
Transporter Name Sodium- and chloride-dependent glycine transporter 1
Gene ID
6536
UniProt ID
P48067
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg00143623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.59E+00 Statistic Test p-value: 4.26E-09; Z-score: -1.99E+00

Methylation in Case

 4.39E-01 (Median) Methylation in Control 7.00E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg04682775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.66E+00 Statistic Test p-value: 3.63E-08; Z-score: 1.58E+00

Methylation in Case

 9.07E-01 (Median) Methylation in Control 5.46E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg10588679)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.99E-07; Z-score: 1.13E+00

Methylation in Case

 7.88E-01 (Median) Methylation in Control 6.96E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC6A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg11207893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 3.14E-07; Z-score: -1.28E+00

Methylation in Case

 7.17E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC6A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg12461125)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.40E+00 Statistic Test p-value: 3.79E-07; Z-score: -1.43E+00

Methylation in Case

 4.51E-01 (Median) Methylation in Control 6.32E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC6A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg15114744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 1.08E-06; Z-score: -1.35E+00

Methylation in Case

 7.43E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC6A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg24524850)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 8.15E-06; Z-score: -8.67E-01

Methylation in Case

 9.00E-01 (Median) Methylation in Control 9.24E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in bladder cancer [ 2 ]

Location

 5'UTR (cg04682775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.63E+00 Statistic Test p-value: 5.23E-09; Z-score: -1.10E+01

Methylation in Case

 2.58E-01 (Median) Methylation in Control 4.19E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A9 in bladder cancer [ 2 ]

Location

 5'UTR (cg11207893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 1.07E-05; Z-score: -2.07E+01

Methylation in Case

 7.19E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A9 in bladder cancer [ 2 ]

Location

 5'UTR (cg12461125)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 1.08E-04; Z-score: -3.35E+00

Methylation in Case

 4.07E-02 (Median) Methylation in Control 5.08E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC6A9 in bladder cancer [ 2 ]

Location

 5'UTR (cg15114744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.02E-04; Z-score: 2.89E+00

Methylation in Case

 8.75E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC6A9 in bladder cancer [ 2 ]

Location

 TSS1500 (cg04093149)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 2.78E-05; Z-score: 3.68E+00

Methylation in Case

 4.90E-01 (Median) Methylation in Control 3.92E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC6A9 in bladder cancer [ 2 ]

Location

 TSS1500 (cg04833514)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.37E+00 Statistic Test p-value: 1.35E-04; Z-score: 3.93E+00

Methylation in Case

 6.87E-01 (Median) Methylation in Control 5.01E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC6A9 in bladder cancer [ 2 ]

Location

 TSS1500 (cg12133952)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.36E+00 Statistic Test p-value: 6.81E-03; Z-score: -3.01E+00

Methylation in Case

 1.46E-01 (Median) Methylation in Control 1.98E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in breast cancer [ 3 ]

Location

 5'UTR (cg15114744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 2.27E-08; Z-score: 1.09E+00

Methylation in Case

 8.55E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A9 in breast cancer [ 3 ]

Location

 5'UTR (cg04682775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 1.21E-03; Z-score: 1.79E+00

Methylation in Case

 3.62E-01 (Median) Methylation in Control 2.98E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A9 in breast cancer [ 3 ]

Location

 TSS1500 (cg12133952)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 1.01E-05; Z-score: 1.90E+00

Methylation in Case

 2.32E-01 (Median) Methylation in Control 1.79E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg10588679)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 4.57E-05; Z-score: 9.06E-01

Methylation in Case

 2.87E-02 (Median) Methylation in Control 2.47E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A9 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg11207893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 9.35E-04; Z-score: 1.48E+00

Methylation in Case

 9.56E-01 (Median) Methylation in Control 9.45E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A9 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg04682775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 2.08E-03; Z-score: 1.96E+00

Methylation in Case

 4.90E-01 (Median) Methylation in Control 3.91E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC6A9 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg12461125)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 1.04E-02; Z-score: 4.69E-01

Methylation in Case

 9.64E-03 (Median) Methylation in Control 8.59E-03 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC6A9 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg12133952)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.45E+00 Statistic Test p-value: 2.88E-05; Z-score: 1.35E+00

Methylation in Case

 2.15E-01 (Median) Methylation in Control 1.48E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC6A9 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg04093149)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 3.02E-05; Z-score: 2.13E+00

Methylation in Case

 5.33E-01 (Median) Methylation in Control 4.25E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC6A9 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg18183642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 1.50E-03; Z-score: 2.68E+00

Methylation in Case

 7.49E-01 (Median) Methylation in Control 6.06E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in colon adenocarcinoma [ 5 ]

Location

 5'UTR (cg19721867)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 6.35E+00 Statistic Test p-value: 2.00E-05; Z-score: 7.38E+00

Methylation in Case

 3.67E-01 (Median) Methylation in Control 5.79E-02 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A9 in colon adenocarcinoma [ 5 ]

Location

 Body (cg07160746)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.45E-05; Z-score: 1.20E+00

Methylation in Case

 6.39E-01 (Median) Methylation in Control 5.63E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A9 in colon adenocarcinoma [ 5 ]

Location

 Body (cg12111714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 1.50E-05; Z-score: 1.06E+00

Methylation in Case

 8.00E-01 (Median) Methylation in Control 7.14E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC6A9 in colon adenocarcinoma [ 5 ]

Location

 Body (cg05942022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 1.85E-04; Z-score: -1.65E+00

Methylation in Case

 4.32E-01 (Median) Methylation in Control 5.17E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC6A9 in colon adenocarcinoma [ 5 ]

Location

 Body (cg25517015)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.69E-04; Z-score: -1.71E+00

Methylation in Case

 7.66E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC6A9 in colon adenocarcinoma [ 5 ]

Location

 Body (cg05778820)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 3.72E-04; Z-score: 1.78E+00

Methylation in Case

 7.64E-01 (Median) Methylation in Control 6.59E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC6A9 in colon adenocarcinoma [ 5 ]

Location

 Body (cg19236645)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.62E-03; Z-score: -1.48E+00

Methylation in Case

 6.48E-01 (Median) Methylation in Control 7.19E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in colorectal cancer [ 6 ]

Location

 5'UTR (cg11207893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.81E-03; Z-score: -9.00E-01

Methylation in Case

 9.40E-01 (Median) Methylation in Control 9.57E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A9 in colorectal cancer [ 6 ]

Location

 5'UTR (cg10588679)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 1.72E-02; Z-score: 7.71E-01

Methylation in Case

 9.64E-02 (Median) Methylation in Control 8.69E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in depression [ 7 ]

Location

 5'UTR (cg10588679)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.23E-02; Z-score: 6.29E-01

Methylation in Case

 6.33E-02 (Median) Methylation in Control 5.91E-02 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in hepatocellular carcinoma [ 8 ]

Location

 5'UTR (cg15114744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.56E-03; Z-score: -1.22E-01

Methylation in Case

 8.46E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A9 in hepatocellular carcinoma [ 8 ]

Location

 5'UTR (cg24524850)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.65E-02; Z-score: 4.91E-01

Methylation in Case

 1.07E-01 (Median) Methylation in Control 9.88E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A9 in hepatocellular carcinoma [ 8 ]

Location

 5'UTR (cg11207893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.51E-02; Z-score: -1.39E-01

Methylation in Case

 9.41E-01 (Median) Methylation in Control 9.45E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC6A9 in hepatocellular carcinoma [ 8 ]

Location

 5'UTR (cg10588679)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 2.94E-02; Z-score: 3.23E-01

Methylation in Case

 6.07E-02 (Median) Methylation in Control 5.80E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC6A9 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg11945507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.52E+00 Statistic Test p-value: 1.55E-16; Z-score: -4.32E+00

Methylation in Case

 5.10E-01 (Median) Methylation in Control 7.75E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC6A9 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg12440751)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.40E+00 Statistic Test p-value: 1.28E-15; Z-score: -5.50E+00

Methylation in Case

 5.71E-01 (Median) Methylation in Control 8.02E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC6A9 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg12092346)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 1.70E-13; Z-score: 2.22E+00

Methylation in Case

 8.10E-01 (Median) Methylation in Control 6.91E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC6A9 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg09648809)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 4.01E-10; Z-score: -5.61E+00

Methylation in Case

 8.04E-01 (Median) Methylation in Control 9.42E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC6A9 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg15338782)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.44E+00 Statistic Test p-value: 9.13E-10; Z-score: -2.52E+00

Methylation in Case

 4.04E-01 (Median) Methylation in Control 5.82E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in HIV infection [ 9 ]

Location

 5'UTR (cg04682775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 6.59E-07; Z-score: 1.48E+00

Methylation in Case

 6.82E-01 (Median) Methylation in Control 6.14E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A9 in HIV infection [ 9 ]

Location

 5'UTR (cg11207893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.67E-02; Z-score: 3.85E-01

Methylation in Case

 9.92E-01 (Median) Methylation in Control 9.85E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A9 in HIV infection [ 9 ]

Location

 TSS1500 (cg12133952)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 1.56E-05; Z-score: 1.56E+00

Methylation in Case

 3.56E-01 (Median) Methylation in Control 3.05E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC6A9 in HIV infection [ 9 ]

Location

 TSS1500 (cg04093149)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 5.96E-04; Z-score: 1.07E+00

Methylation in Case

 8.84E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC6A9 in HIV infection [ 9 ]

Location

 TSS1500 (cg04833514)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.52E-03; Z-score: 3.26E-01

Methylation in Case

 8.77E-01 (Median) Methylation in Control 8.70E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in lung adenocarcinoma [ 10 ]

Location

 5'UTR (cg15114744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 6.77E-03; Z-score: 1.28E+00

Methylation in Case

 8.75E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A9 in lung adenocarcinoma [ 10 ]

Location

 5'UTR (cg04682775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 4.30E-02; Z-score: 1.82E+00

Methylation in Case

 5.91E-01 (Median) Methylation in Control 5.15E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A9 in lung adenocarcinoma [ 10 ]

Location

 TSS1500 (cg18183642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 8.94E-03; Z-score: 3.34E+00

Methylation in Case

 7.53E-01 (Median) Methylation in Control 6.38E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC6A9 in lung adenocarcinoma [ 10 ]

Location

 TSS1500 (cg04833514)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.71E-02; Z-score: 1.47E+00

Methylation in Case

 7.58E-01 (Median) Methylation in Control 7.08E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC6A9 in lung adenocarcinoma [ 10 ]

Location

 TSS1500 (cg12133952)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 4.69E-02; Z-score: 3.31E+00

Methylation in Case

 3.52E-01 (Median) Methylation in Control 2.93E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in pancretic ductal adenocarcinoma [ 11 ]

Location

 5'UTR (cg09552652)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 8.04E-05; Z-score: 1.46E+00

Methylation in Case

 6.99E-01 (Median) Methylation in Control 6.33E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A9 in pancretic ductal adenocarcinoma [ 11 ]

Location

 Body (cg13767768)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.98E-09; Z-score: -9.27E-01

Methylation in Case

 8.80E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in panic disorder [ 12 ]

Location

 5'UTR (cg00143623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 9.86E-01 Statistic Test p-value: 1.28E-02; Z-score: 2.96E-01

Methylation in Case

 -4.72E+00 (Median) Methylation in Control -4.78E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A9 in panic disorder [ 12 ]

Location

 5'UTR (cg15114744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 2.35E-02; Z-score: 3.46E-01

Methylation in Case

 3.26E+00 (Median) Methylation in Control 3.15E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in systemic lupus erythematosus [ 13 ]

Location

 5'UTR (cg00143623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.38E-02; Z-score: -1.80E-01

Methylation in Case

 7.27E-02 (Median) Methylation in Control 7.58E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC6A9 in systemic lupus erythematosus [ 13 ]

Location

 5'UTR (cg04682775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.46E-02; Z-score: 9.86E-02

Methylation in Case

 6.80E-01 (Median) Methylation in Control 6.75E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC6A9 in systemic lupus erythematosus [ 13 ]

Location

 5'UTR (cg10588679)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.15E-02; Z-score: -1.56E-01

Methylation in Case

 8.31E-02 (Median) Methylation in Control 8.56E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in papillary thyroid cancer [ 14 ]

Location

 TSS1500 (cg04833514)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 3.36E-06; Z-score: 1.10E+00

Methylation in Case

 6.46E-01 (Median) Methylation in Control 5.62E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC6A9 in prostate cancer [ 15 ]

Location

 TSS1500 (cg00727912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.43E+00 Statistic Test p-value: 4.37E-02; Z-score: 5.34E+00

Methylation in Case

 5.44E-01 (Median) Methylation in Control 3.82E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Arterial aneurysm

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypermethylation of SLC6A9 in arterial aneurysm than that in healthy individual

Studied Phenotype

 Arterial aneurysm [ICD-11:BD51]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.002990999; Fold-change: 0.458538016; Z-score: 1.637808379
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section
Download DT methylation data in the tissue of healthy individual

  Brain neuroepithelial tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC6A9 in brain neuroepithelial tumour than that in healthy individual

Studied Phenotype

 Brain neuroepithelial tumour [ICD-11:2A00.2Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 4.41E-20; Fold-change: -0.34785182; Z-score: -1.69584376
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Glioblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC6A9 in glioblastoma than that in healthy individual

Studied Phenotype

 Glioblastoma [ICD-11:2A00.00]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 4.57E-07; Fold-change: -0.513340354; Z-score: -2.034342377
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

          18 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-103a directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-103a miRNA Mature ID miR-103a-3p

miRNA Sequence

 AGCAGCAUUGUACAGGGCUAUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-221 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-221 miRNA Mature ID miR-221-3p

miRNA Sequence

 AGCUACAUUGUCUGCUGGGUUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-26b directly targets SLC6A9 [ 17 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 4

 miR-3122 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3122 miRNA Mature ID miR-3122

miRNA Sequence

 GUUGGGACAAGAGGACGGUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-335 directly targets SLC6A9 [ 18 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-3616 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3616 miRNA Mature ID miR-3616-3p

miRNA Sequence

 CGAGGGCAUUUCAUGAUGCAGGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-3913 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3913 miRNA Mature ID miR-3913-5p

miRNA Sequence

 UUUGGGACUGAUCUUGAUGUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-4436b directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4436b miRNA Mature ID miR-4436b-3p

miRNA Sequence

 CAGGGCAGGAAGAAGUGGACAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-4463 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4463 miRNA Mature ID miR-4463

miRNA Sequence

 GAGACUGGGGUGGGGCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-4632 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4632 miRNA Mature ID miR-4632-5p

miRNA Sequence

 GAGGGCAGCGUGGGUGUGGCGGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-4747 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4747 miRNA Mature ID miR-4747-5p

miRNA Sequence

 AGGGAAGGAGGCUUGGUCUUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-5196 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5196 miRNA Mature ID miR-5196-5p

miRNA Sequence

 AGGGAAGGGGACGAGGGUUGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-6513 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6513 miRNA Mature ID miR-6513-5p

miRNA Sequence

 UUUGGGAUUGACGCCACAUGUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 14

 miR-6735 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6735 miRNA Mature ID miR-6735-5p

miRNA Sequence

 CAGGGCAGAGGGCACAGGAAUCUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-6879 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6879 miRNA Mature ID miR-6879-5p

miRNA Sequence

 CAGGGCAGGGAAGGUGGGAGAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-7 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Sequencing//PAR-CLIP

miRNA Stemloop ID

 miR-7 miRNA Mature ID miR-7-5p

miRNA Sequence

 UGGAAGACUAGUGAUUUUGUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-7843 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7843 miRNA Mature ID miR-7843-5p

miRNA Sequence

 GAGGGCAGAGCCAGCUUCCUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 18

 miR-887 directly targets SLC6A9 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-887 miRNA Mature ID miR-887-5p

miRNA Sequence

 CUUGGGAGCCCUGUUAGACUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
8 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
12 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
15 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
16 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
17 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
18 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.