Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0464 Transporter Info | ||||
| Gene Name | SLC7A11 | ||||
| Transporter Name | Cystine/glutamate transporter | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Pancretic ductal adenocarcinoma |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A11 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg10265016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 1.02E-06; Z-score: 1.35E+00 | ||
|
Methylation in Case |
5.69E-01 (Median) | Methylation in Control | 4.41E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A11 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg18935813) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.80E+00 | Statistic Test | p-value: 5.22E-18; Z-score: 1.56E+00 | ||
|
Methylation in Case |
7.22E-02 (Median) | Methylation in Control | 4.02E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A11 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg07354253) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 1.98E-07; Z-score: -1.35E+00 | ||
|
Methylation in Case |
1.23E-01 (Median) | Methylation in Control | 1.51E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A11 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
1stExon (cg25437385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.35E+00 | Statistic Test | p-value: 5.50E-07; Z-score: 4.92E-01 | ||
|
Methylation in Case |
7.68E-02 (Median) | Methylation in Control | 5.68E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A11 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg03731131) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.42E+00 | Statistic Test | p-value: 2.18E-07; Z-score: 1.55E+00 | ||
|
Methylation in Case |
6.38E-01 (Median) | Methylation in Control | 4.49E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A11 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg24733435) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 4.47E-03; Z-score: 7.17E-01 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A11 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg04433051) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.39E+00 | Statistic Test | p-value: 6.56E-03; Z-score: -9.30E-01 | ||
|
Methylation in Case |
3.47E-01 (Median) | Methylation in Control | 4.84E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A11 in breast cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg00361146) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 1.55E-02; Z-score: 4.19E-01 | ||
|
Methylation in Case |
4.76E-02 (Median) | Methylation in Control | 4.06E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A11 in breast cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg02102889) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.04E-02; Z-score: -4.66E-01 | ||
|
Methylation in Case |
7.06E-01 (Median) | Methylation in Control | 7.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A11 in breast cancer | [ 2 ] | |||
|
Location |
Body (cg21877274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 4.72E-12; Z-score: -2.66E+00 | ||
|
Methylation in Case |
8.24E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A11 in breast cancer | [ 2 ] | |||
|
Location |
Body (cg24869834) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 8.41E-10; Z-score: -1.78E+00 | ||
|
Methylation in Case |
7.52E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A11 in breast cancer | [ 2 ] | |||
|
Location |
Body (cg02734904) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.88E-07; Z-score: -1.42E+00 | ||
|
Methylation in Case |
8.59E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A11 in breast cancer | [ 2 ] | |||
|
Location |
Body (cg01309945) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 5.23E-05; Z-score: -1.22E+00 | ||
|
Methylation in Case |
8.43E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A11 in breast cancer | [ 2 ] | |||
|
Location |
Body (cg04487857) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 5.55E-05; Z-score: 1.88E+00 | ||
|
Methylation in Case |
6.12E-01 (Median) | Methylation in Control | 5.06E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A11 in breast cancer | [ 2 ] | |||
|
Location |
Body (cg06206831) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 8.72E-05; Z-score: -1.09E+00 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC7A11 in breast cancer | [ 2 ] | |||
|
Location |
Body (cg15867963) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.25E-04; Z-score: 1.35E+00 | ||
|
Methylation in Case |
6.73E-01 (Median) | Methylation in Control | 5.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A11 in colorectal cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg02102889) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 4.78E-08; Z-score: -2.02E+00 | ||
|
Methylation in Case |
7.50E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A11 in colorectal cancer | [ 3 ] | |||
|
Location |
Body (cg15867963) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 2.01E-07; Z-score: 1.77E+00 | ||
|
Methylation in Case |
7.51E-01 (Median) | Methylation in Control | 5.47E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A11 in colorectal cancer | [ 3 ] | |||
|
Location |
Body (cg01309945) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.45E-07; Z-score: -1.78E+00 | ||
|
Methylation in Case |
8.72E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A11 in colorectal cancer | [ 3 ] | |||
|
Location |
Body (cg04487857) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.42E+00 | Statistic Test | p-value: 1.75E-05; Z-score: 1.54E+00 | ||
|
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 4.76E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A11 in colorectal cancer | [ 3 ] | |||
|
Location |
Body (cg15441006) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.09E-02; Z-score: -5.70E-01 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 7.97E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg02102889) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 5.81E-08; Z-score: -8.95E-01 | ||
|
Methylation in Case |
7.03E-01 (Median) | Methylation in Control | 7.76E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
1stExon (cg16399511) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.59E+00 | Statistic Test | p-value: 2.78E-23; Z-score: -4.76E+00 | ||
|
Methylation in Case |
4.45E-01 (Median) | Methylation in Control | 7.08E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg21460403) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.01E+00 | Statistic Test | p-value: 4.49E-22; Z-score: -5.12E+00 | ||
|
Methylation in Case |
3.38E-01 (Median) | Methylation in Control | 6.79E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg07845352) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.72E+00 | Statistic Test | p-value: 3.05E-17; Z-score: -2.86E+00 | ||
|
Methylation in Case |
3.75E-01 (Median) | Methylation in Control | 6.46E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg20141652) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 2.65E-12; Z-score: 1.87E+00 | ||
|
Methylation in Case |
5.21E-01 (Median) | Methylation in Control | 4.30E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg19063061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.25E+00 | Statistic Test | p-value: 5.72E-11; Z-score: 3.86E+00 | ||
|
Methylation in Case |
4.57E-01 (Median) | Methylation in Control | 2.03E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg06690548) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 9.71E-09; Z-score: -1.89E+00 | ||
|
Methylation in Case |
5.53E-01 (Median) | Methylation in Control | 6.94E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg02734904) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 4.02E-08; Z-score: -2.11E+00 | ||
|
Methylation in Case |
7.36E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg21877274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 9.67E-08; Z-score: -2.65E+00 | ||
|
Methylation in Case |
7.19E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg07661704) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 5.68E-06; Z-score: -8.84E-01 | ||
|
Methylation in Case |
6.11E-01 (Median) | Methylation in Control | 6.56E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg04474257) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.11E-05; Z-score: -1.06E+00 | ||
|
Methylation in Case |
6.59E-01 (Median) | Methylation in Control | 7.20E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg15867963) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.34E-05; Z-score: -1.94E+00 | ||
|
Methylation in Case |
6.27E-01 (Median) | Methylation in Control | 7.10E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg06206831) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.42E-05; Z-score: -8.87E-01 | ||
|
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg01309945) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.50E-05; Z-score: -8.60E-01 | ||
|
Methylation in Case |
7.77E-01 (Median) | Methylation in Control | 8.07E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg06623625) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.43E-04; Z-score: -6.03E-01 | ||
|
Methylation in Case |
7.00E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg15441006) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.36E-03; Z-score: -2.62E-01 | ||
|
Methylation in Case |
6.89E-01 (Median) | Methylation in Control | 7.23E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC7A11 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg24869834) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.04E-02; Z-score: -3.20E-01 | ||
|
Methylation in Case |
5.90E-01 (Median) | Methylation in Control | 6.11E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A11 in HIV infection | [ 5 ] | |||
|
Location |
TSS1500 (cg02102889) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.05E-02; Z-score: -4.46E-01 | ||
|
Methylation in Case |
8.22E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A11 in HIV infection | [ 5 ] | |||
|
Location |
Body (cg07661704) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 6.38E-10; Z-score: 2.08E+00 | ||
|
Methylation in Case |
7.24E-01 (Median) | Methylation in Control | 5.69E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A11 in HIV infection | [ 5 ] | |||
|
Location |
Body (cg24869834) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.97E-06; Z-score: -1.50E+00 | ||
|
Methylation in Case |
7.83E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A11 in HIV infection | [ 5 ] | |||
|
Location |
Body (cg21877274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.71E-05; Z-score: -1.89E+00 | ||
|
Methylation in Case |
8.56E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A11 in HIV infection | [ 5 ] | |||
|
Location |
Body (cg06623625) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 9.46E-03; Z-score: -8.07E-01 | ||
|
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A11 in HIV infection | [ 5 ] | |||
|
Location |
Body (cg06206831) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.18E-02; Z-score: -6.84E-01 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A11 in panic disorder | [ 6 ] | |||
|
Location |
TSS1500 (cg02102889) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -8.38E-01 | Statistic Test | p-value: 3.71E-04; Z-score: -5.16E-01 | ||
|
Methylation in Case |
-8.51E-01 (Median) | Methylation in Control | -7.14E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A11 in panic disorder | [ 6 ] | |||
|
Location |
Body (cg24869834) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -4.41E-01 | Statistic Test | p-value: 1.08E-06; Z-score: -9.06E-01 | ||
|
Methylation in Case |
-5.96E-01 (Median) | Methylation in Control | -2.63E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A11 in panic disorder | [ 6 ] | |||
|
Location |
Body (cg02734904) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 7.18E-04; Z-score: -5.25E-01 | ||
|
Methylation in Case |
7.46E-01 (Median) | Methylation in Control | 1.01E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A11 in panic disorder | [ 6 ] | |||
|
Location |
Body (cg04487857) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 2.21E-02; Z-score: 5.65E-01 | ||
|
Methylation in Case |
2.47E+00 (Median) | Methylation in Control | 2.33E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A11 in prostate cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg11200963) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.36E+00 | Statistic Test | p-value: 2.95E-02; Z-score: 2.45E+00 | ||
|
Methylation in Case |
7.33E-01 (Median) | Methylation in Control | 5.37E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A11 in prostate cancer | [ 7 ] | |||
|
Location |
3'UTR (cg19926635) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.62E-02; Z-score: 1.95E+00 | ||
|
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 6.55E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A11 in systemic lupus erythematosus | [ 8 ] | |||
|
Location |
TSS1500 (cg00361146) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 1.38E-03; Z-score: -2.21E-01 | ||
|
Methylation in Case |
8.24E-02 (Median) | Methylation in Control | 9.21E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A11 in systemic lupus erythematosus | [ 8 ] | |||
|
Location |
TSS1500 (cg02102889) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 2.70E-02; Z-score: 3.66E-01 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 7.00E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A11 in systemic lupus erythematosus | [ 8 ] | |||
|
Location |
Body (cg07661704) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 2.08E-07; Z-score: 5.52E-01 | ||
|
Methylation in Case |
6.34E-01 (Median) | Methylation in Control | 5.94E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A11 in systemic lupus erythematosus | [ 8 ] | |||
|
Location |
Body (cg01309945) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.29E-03; Z-score: -1.95E-01 | ||
|
Methylation in Case |
8.95E-01 (Median) | Methylation in Control | 9.00E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A11 in systemic lupus erythematosus | [ 8 ] | |||
|
Location |
Body (cg06623625) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 2.67E-02; Z-score: -1.57E-01 | ||
|
Methylation in Case |
9.18E-01 (Median) | Methylation in Control | 9.21E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A11 in systemic lupus erythematosus | [ 8 ] | |||
|
Location |
Body (cg21877274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.72E-02; Z-score: -1.61E-01 | ||
|
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 8.87E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A11 in bladder cancer | [ 9 ] | |||
|
Location |
TSS200 (cg13028471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.33E+00 | Statistic Test | p-value: 5.55E-03; Z-score: -2.15E+00 | ||
|
Methylation in Case |
3.83E-02 (Median) | Methylation in Control | 8.90E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A11 in bladder cancer | [ 9 ] | |||
|
Location |
Body (cg15867963) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.65E+00 | Statistic Test | p-value: 6.57E-07; Z-score: 5.61E+00 | ||
|
Methylation in Case |
7.30E-01 (Median) | Methylation in Control | 4.42E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A11 in bladder cancer | [ 9 ] | |||
|
Location |
Body (cg06690548) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.57E+00 | Statistic Test | p-value: 6.76E-07; Z-score: -5.59E+00 | ||
|
Methylation in Case |
3.93E-01 (Median) | Methylation in Control | 6.16E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A11 in bladder cancer | [ 9 ] | |||
|
Location |
Body (cg24869834) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 2.06E-05; Z-score: -7.07E+00 | ||
|
Methylation in Case |
6.96E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A11 in bladder cancer | [ 9 ] | |||
|
Location |
Body (cg02734904) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.16E-03; Z-score: -3.93E+00 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A11 in bladder cancer | [ 9 ] | |||
|
Location |
Body (cg04487857) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.92E+00 | Statistic Test | p-value: 1.81E-03; Z-score: -3.67E+00 | ||
|
Methylation in Case |
1.97E-01 (Median) | Methylation in Control | 3.78E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A11 in bladder cancer | [ 9 ] | |||
|
Location |
Body (cg06206831) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.66E-03; Z-score: -2.16E+00 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 9.08E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A11 in bladder cancer | [ 9 ] | |||
|
Location |
Body (cg21877274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 9.83E-03; Z-score: -1.95E+00 | ||
|
Methylation in Case |
8.38E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A11 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg13028471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.00E+00 | Statistic Test | p-value: 1.44E-03; Z-score: -1.77E+00 | ||
|
Methylation in Case |
1.06E-01 (Median) | Methylation in Control | 2.12E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A11 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg21877274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.74E-03; Z-score: -1.85E+00 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 8.70E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A11 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg24869834) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 5.63E-03; Z-score: -2.74E+00 | ||
|
Methylation in Case |
7.60E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A11 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg06623625) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.46E-02; Z-score: 9.92E-01 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A11 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg04474257) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.49E-02; Z-score: -2.06E+00 | ||
|
Methylation in Case |
7.89E-01 (Median) | Methylation in Control | 8.28E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A11 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
TSS200 (cg13028471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 2.70E-06; Z-score: -7.00E-01 | ||
|
Methylation in Case |
5.14E-02 (Median) | Methylation in Control | 5.80E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A11 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg04487857) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.62E+00 | Statistic Test | p-value: 3.83E-11; Z-score: 2.00E+00 | ||
|
Methylation in Case |
3.43E-01 (Median) | Methylation in Control | 2.12E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A11 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg15441006) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.06E-08; Z-score: -1.46E+00 | ||
|
Methylation in Case |
7.89E-01 (Median) | Methylation in Control | 8.23E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A11 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg06623625) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 7.43E-07; Z-score: 1.57E+00 | ||
|
Methylation in Case |
9.07E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A11 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg15867963) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.31E+00 | Statistic Test | p-value: 1.21E-06; Z-score: 1.34E+00 | ||
|
Methylation in Case |
4.16E-01 (Median) | Methylation in Control | 3.17E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A11 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg24869834) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.15E-03; Z-score: -7.38E-01 | ||
|
Methylation in Case |
8.69E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A11 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg07661704) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.28E-02; Z-score: 5.33E-01 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A11 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg06206831) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.36E-02; Z-score: -5.09E-01 | ||
|
Methylation in Case |
9.46E-01 (Median) | Methylation in Control | 9.51E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC7A11 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg01309945) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 6.08E-05; Z-score: -1.05E+00 | ||
|
Methylation in Case |
4.03E-01 (Median) | Methylation in Control | 5.01E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC7A11 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg02734904) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.49E+00 | Statistic Test | p-value: 2.23E-04; Z-score: -1.06E+00 | ||
|
Methylation in Case |
2.18E-01 (Median) | Methylation in Control | 3.25E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC7A11 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg04474257) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.39E+00 | Statistic Test | p-value: 7.96E-04; Z-score: -1.11E+00 | ||
|
Methylation in Case |
3.33E-01 (Median) | Methylation in Control | 4.61E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC7A11 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg04487857) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 8.25E-04; Z-score: -5.86E-01 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.79E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC7A11 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06206831) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 2.24E-03; Z-score: -5.75E-01 | ||
|
Methylation in Case |
2.75E-01 (Median) | Methylation in Control | 3.60E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC7A11 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06623625) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 2.69E-03; Z-score: 7.31E-01 | ||
|
Methylation in Case |
9.29E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC7A11 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06690548) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 2.81E-03; Z-score: -6.57E-01 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC7A11 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg07661704) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 4.69E-03; Z-score: 4.54E-01 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC7A11 in atypical teratoid rhabdoid tumour than that in healthy individual | ||||
Studied Phenotype |
Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 8.25E-07; Fold-change: 0.261444373; Z-score: 1.115094393 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC7A11 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.08E-05; Fold-change: 0.283373055; Z-score: 1.202963567 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Ovarian cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC7A11 in ovarian cancer than that in healthy individual | ||||
Studied Phenotype |
Ovarian cancer [ICD-11:2C73] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.013425961; Fold-change: -0.231306815; Z-score: -1.638472872 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
RELA YAP fusion ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC7A11 in rela yap fusion ependymoma than that in healthy individual | ||||
Studied Phenotype |
RELA YAP fusion ependymoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 2.98E-05; Fold-change: -0.206680629; Z-score: -1.196204455 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Cerebellar liponeurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC7A11 in cerebellar liponeurocytoma than that in healthy individual | ||||
Studied Phenotype |
Cerebellar liponeurocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.59E-09; Fold-change: 0.742532468; Z-score: 4.38326707 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Medulloblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC7A11 in medulloblastoma than that in healthy individual | ||||
Studied Phenotype |
Medulloblastoma [ICD-11:2A00.10] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.78E-79; Fold-change: 0.659515713; Z-score: 4.783181087 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Melanocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC7A11 in melanocytoma than that in healthy individual | ||||
Studied Phenotype |
Melanocytoma [ICD-11:2F36.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.36E-08; Fold-change: 0.434857324; Z-score: 2.742889307 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Multilayered rosettes embryonal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC7A11 in multilayered rosettes embryonal tumour than that in healthy individual | ||||
Studied Phenotype |
Multilayered rosettes embryonal tumour [ICD-11:2A00.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 5.66E-10; Fold-change: 0.454182284; Z-score: 1.916855181 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Oligodendroglioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC7A11 in oligodendroglioma than that in healthy individual | ||||
Studied Phenotype |
Oligodendroglioma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.88E-17; Fold-change: 0.34605996; Z-score: 1.714338 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Third ventricle chordoid glioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC7A11 in third ventricle chordoid glioma than that in healthy individual | ||||
Studied Phenotype |
Third ventricle chordoid glioma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.002176722; Fold-change: 0.379485646; Z-score: 2.569119328 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Lung cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC7A11 in lung cancer than that in adjacent tissue | ||||
Studied Phenotype |
Lung cancer [ICD-11:2C25] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value: 0.00234939; Fold-change: -0.230223429; Z-score: -1.916233374 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
|
microRNA |
|||||
|
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Higher expression of miR-27a in bladder cancer (compare with cisplatin-resistant counterpart cells) | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Dual-luciferase reporter assay | ||
|
Related Molecular Changes |
Down regulation of SLC7A11 | Experiment Method | Western Blot | ||
|
miRNA Stemloop ID |
miR-27a | miRNA Mature ID | miR-27a-3p | ||
|
miRNA Sequence |
UUCACAGUGGCUAAGUUCCGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
miR-27a overexpression may increase the sensitivity of bladder cancer cells to cisplatin by targeting SLC7A11. | ||||
|
Unclear Phenotype |
95 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-1 directly targets SLC7A11 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1 | miRNA Mature ID | miR-1-5p | ||
|
miRNA Sequence |
ACAUACUUCUUUAUAUGCCCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 2 |
miR-106a directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-106a | miRNA Mature ID | miR-106a-5p | ||
|
miRNA Sequence |
AAAAGUGCUUACAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 3 |
miR-106b directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-106b | miRNA Mature ID | miR-106b-5p | ||
|
miRNA Sequence |
UAAAGUGCUGACAGUGCAGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 4 |
miR-1247 directly targets SLC7A11 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1247 | miRNA Mature ID | miR-1247-3p | ||
|
miRNA Sequence |
CCCCGGGAACGUCGAGACUGGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 5 |
miR-1277 directly targets SLC7A11 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1277 | miRNA Mature ID | miR-1277-5p | ||
|
miRNA Sequence |
AAAUAUAUAUAUAUAUGUACGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 6 |
miR-1279 directly targets SLC7A11 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1279 | miRNA Mature ID | miR-1279 | ||
|
miRNA Sequence |
UCAUAUUGCUUCUUUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 7 |
miR-128 directly targets SLC7A11 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-128 | miRNA Mature ID | miR-128-3p | ||
|
miRNA Sequence |
UCACAGUGAACCGGUCUCUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon 8 |
miR-1281 directly targets SLC7A11 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1281 | miRNA Mature ID | miR-1281 | ||
|
miRNA Sequence |
UCGCCUCCUCCUCUCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 9 |
miR-142 directly targets SLC7A11 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-142 | miRNA Mature ID | miR-142-3p | ||
|
miRNA Sequence |
UGUAGUGUUUCCUACUUUAUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-148b directly targets SLC7A11 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-148b | miRNA Mature ID | miR-148b-3p | ||
|
miRNA Sequence |
UCAGUGCAUCACAGAACUUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon 11 |
miR-150 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-150 | miRNA Mature ID | miR-150-5p | ||
|
miRNA Sequence |
UCUCCCAACCCUUGUACCAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 12 |
miR-155 directly targets SLC7A11 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
|
miRNA Stemloop ID |
miR-155 | miRNA Mature ID | miR-155-5p | ||
|
miRNA Sequence |
UUAAUGCUAAUCGUGAUAGGGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon 13 |
miR-17 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-17 | miRNA Mature ID | miR-17-5p | ||
|
miRNA Sequence |
CAAAGUGCUUACAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 14 |
miR-181a directly targets SLC7A11 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-181a | miRNA Mature ID | miR-181a-5p | ||
|
miRNA Sequence |
AACAUUCAACGCUGUCGGUGAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon 15 |
miR-186 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-3p | ||
|
miRNA Sequence |
GCCCAAAGGUGAAUUUUUUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 16 |
miR-190a directly targets SLC7A11 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-190a | miRNA Mature ID | miR-190a-3p | ||
|
miRNA Sequence |
CUAUAUAUCAAACAUAUUCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 17 |
miR-192 directly targets SLC7A11 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-192 | miRNA Mature ID | miR-192-5p | ||
|
miRNA Sequence |
CUGACCUAUGAAUUGACAGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 18 |
miR-1976 directly targets SLC7A11 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1976 | miRNA Mature ID | miR-1976 | ||
|
miRNA Sequence |
CCUCCUGCCCUCCUUGCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 19 |
miR-19a directly targets SLC7A11 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-19a | miRNA Mature ID | miR-19a-3p | ||
|
miRNA Sequence |
UGUGCAAAUCUAUGCAAAACUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 20 |
miR-19b directly targets SLC7A11 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-19b | miRNA Mature ID | miR-19b-3p | ||
|
miRNA Sequence |
UGUGCAAAUCCAUGCAAAACUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 21 |
miR-20a directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-20a | miRNA Mature ID | miR-20a-5p | ||
|
miRNA Sequence |
UAAAGUGCUUAUAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 22 |
miR-20b directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-20b | miRNA Mature ID | miR-20b-5p | ||
|
miRNA Sequence |
CAAAGUGCUCAUAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 23 |
miR-215 directly targets SLC7A11 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-215 | miRNA Mature ID | miR-215-5p | ||
|
miRNA Sequence |
AUGACCUAUGAAUUGACAGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 24 |
miR-218 directly targets SLC7A11 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-218 | miRNA Mature ID | miR-218-5p | ||
|
miRNA Sequence |
UUGUGCUUGAUCUAACCAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 25 |
miR-223 directly targets SLC7A11 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-223 | miRNA Mature ID | miR-223-5p | ||
|
miRNA Sequence |
CGUGUAUUUGACAAGCUGAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 26 |
miR-25 directly targets SLC7A11 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-25 | miRNA Mature ID | miR-25-3p | ||
|
miRNA Sequence |
CAUUGCACUUGUCUCGGUCUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 27 |
miR-26b directly targets SLC7A11 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Sequencing | ||
|
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
|
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 28 |
miR-27a directly targets SLC7A11 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Immunohistochemistry//Luciferase reporter assay//qRT-PCR | ||
|
miRNA Stemloop ID |
miR-27a | miRNA Mature ID | miR-27a-3p | ||
|
miRNA Sequence |
UUCACAGUGGCUAAGUUCCGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 29 |
miR-302a directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-302a | miRNA Mature ID | miR-302a-3p | ||
|
miRNA Sequence |
UAAGUGCUUCCAUGUUUUGGUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 30 |
miR-302b directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-302b | miRNA Mature ID | miR-302b-3p | ||
|
miRNA Sequence |
UAAGUGCUUCCAUGUUUUAGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 31 |
miR-302c directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-302c | miRNA Mature ID | miR-302c-3p | ||
|
miRNA Sequence |
UAAGUGCUUCCAUGUUUCAGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 32 |
miR-302d directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-302d | miRNA Mature ID | miR-302d-3p | ||
|
miRNA Sequence |
UAAGUGCUUCCAUGUUUGAGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 33 |
miR-302e directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-302e | miRNA Mature ID | miR-302e | ||
|
miRNA Sequence |
UAAGUGCUUCCAUGCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 34 |
miR-30a directly targets SLC7A11 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | pSILAC//Proteomics;Other | ||
|
miRNA Stemloop ID |
miR-30a | miRNA Mature ID | miR-30a-5p | ||
|
miRNA Sequence |
UGUAAACAUCCUCGACUGGAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon 35 |
miR-3163 directly targets SLC7A11 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3163 | miRNA Mature ID | miR-3163 | ||
|
miRNA Sequence |
UAUAAAAUGAGGGCAGUAAGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 36 |
miR-32 directly targets SLC7A11 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-32 | miRNA Mature ID | miR-32-5p | ||
|
miRNA Sequence |
UAUUGCACAUUACUAAGUUGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 37 |
miR-329 directly targets SLC7A11 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-329 | miRNA Mature ID | miR-329-3p | ||
|
miRNA Sequence |
AACACACCUGGUUAACCUCUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 38 |
miR-340 directly targets SLC7A11 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Sequencing | ||
|
miRNA Stemloop ID |
miR-340 | miRNA Mature ID | miR-340-5p | ||
|
miRNA Sequence |
UUAUAAAGCAAUGAGACUGAUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 39 |
miR-362 directly targets SLC7A11 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-362 | miRNA Mature ID | miR-362-3p | ||
|
miRNA Sequence |
AACACACCUAUUCAAGGAUUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 40 |
miR-363 directly targets SLC7A11 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-363 | miRNA Mature ID | miR-363-3p | ||
|
miRNA Sequence |
AAUUGCACGGUAUCCAUCUGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 41 |
miR-367 directly targets SLC7A11 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-367 | miRNA Mature ID | miR-367-3p | ||
|
miRNA Sequence |
AAUUGCACUUUAGCAAUGGUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 42 |
miR-372 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-372 | miRNA Mature ID | miR-372-3p | ||
|
miRNA Sequence |
AAAGUGCUGCGACAUUUGAGCGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 43 |
miR-373 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-373 | miRNA Mature ID | miR-373-3p | ||
|
miRNA Sequence |
GAAGUGCUUCGAUUUUGGGGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 44 |
miR-3913 directly targets SLC7A11 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3913 | miRNA Mature ID | miR-3913-3p | ||
|
miRNA Sequence |
AGACAUCAAGAUCAGUCCCAAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 45 |
miR-3941 directly targets SLC7A11 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3941 | miRNA Mature ID | miR-3941 | ||
|
miRNA Sequence |
UUACACACAACUGAGGAUCAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 46 |
miR-410 directly targets SLC7A11 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-410 | miRNA Mature ID | miR-410-3p | ||
|
miRNA Sequence |
AAUAUAACACAGAUGGCCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 47 |
miR-4279 directly targets SLC7A11 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4279 | miRNA Mature ID | miR-4279 | ||
|
miRNA Sequence |
CUCUCCUCCCGGCUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 48 |
miR-4282 directly targets SLC7A11 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4282 | miRNA Mature ID | miR-4282 | ||
|
miRNA Sequence |
UAAAAUUUGCAUCCAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 49 |
miR-4640 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4640 | miRNA Mature ID | miR-4640-3p | ||
|
miRNA Sequence |
CACCCCCUGUUUCCUGGCCCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 50 |
miR-4722 directly targets SLC7A11 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4722 | miRNA Mature ID | miR-4722-3p | ||
|
miRNA Sequence |
ACCUGCCAGCACCUCCCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 51 |
miR-4731 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4731 | miRNA Mature ID | miR-4731-5p | ||
|
miRNA Sequence |
UGCUGGGGGCCACAUGAGUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 52 |
miR-4789 directly targets SLC7A11 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4789 | miRNA Mature ID | miR-4789-3p | ||
|
miRNA Sequence |
CACACAUAGCAGGUGUAUAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 53 |
miR-4789 directly targets SLC7A11 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4789 | miRNA Mature ID | miR-4789-5p | ||
|
miRNA Sequence |
GUAUACACCUGAUAUGUGUAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 54 |
miR-489 directly targets SLC7A11 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-489 | miRNA Mature ID | miR-489-3p | ||
|
miRNA Sequence |
GUGACAUCACAUAUACGGCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 55 |
miR-500a directly targets SLC7A11 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-500a | miRNA Mature ID | miR-500a-3p | ||
|
miRNA Sequence |
AUGCACCUGGGCAAGGAUUCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 56 |
miR-5011 directly targets SLC7A11 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5011 | miRNA Mature ID | miR-5011-5p | ||
|
miRNA Sequence |
UAUAUAUACAGCCAUGCACUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 57 |
miR-505 directly targets SLC7A11 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-505 | miRNA Mature ID | miR-505-5p | ||
|
miRNA Sequence |
GGGAGCCAGGAAGUAUUGAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 58 |
miR-5089 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5089 | miRNA Mature ID | miR-5089-5p | ||
|
miRNA Sequence |
GUGGGAUUUCUGAGUAGCAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 59 |
miR-512 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-512 | miRNA Mature ID | miR-512-3p | ||
|
miRNA Sequence |
AAGUGCUGUCAUAGCUGAGGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 60 |
miR-5193 directly targets SLC7A11 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5193 | miRNA Mature ID | miR-5193 | ||
|
miRNA Sequence |
UCCUCCUCUACCUCAUCCCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 61 |
miR-519d directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-519d | miRNA Mature ID | miR-519d-3p | ||
|
miRNA Sequence |
CAAAGUGCCUCCCUUUAGAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 62 |
miR-520a directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-520a | miRNA Mature ID | miR-520a-3p | ||
|
miRNA Sequence |
AAAGUGCUUCCCUUUGGACUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 63 |
miR-520c directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-520c | miRNA Mature ID | miR-520c-3p | ||
|
miRNA Sequence |
AAAGUGCUUCCUUUUAGAGGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 64 |
miR-520d directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-520d | miRNA Mature ID | miR-520d-3p | ||
|
miRNA Sequence |
AAAGUGCUUCUCUUUGGUGGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 65 |
miR-520g directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-520g | miRNA Mature ID | miR-520g-3p | ||
|
miRNA Sequence |
ACAAAGUGCUUCCCUUUAGAGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 66 |
miR-520h directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-520h | miRNA Mature ID | miR-520h | ||
|
miRNA Sequence |
ACAAAGUGCUUCCCUUUAGAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 67 |
miR-526b directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-526b | miRNA Mature ID | miR-526b-3p | ||
|
miRNA Sequence |
GAAAGUGCUUCCUUUUAGAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 68 |
miR-548az directly targets SLC7A11 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548az | miRNA Mature ID | miR-548az-5p | ||
|
miRNA Sequence |
CAAAAGUGAUUGUGGUUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 69 |
miR-548e directly targets SLC7A11 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548e | miRNA Mature ID | miR-548e-5p | ||
|
miRNA Sequence |
CAAAAGCAAUCGCGGUUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 70 |
miR-548t directly targets SLC7A11 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548t | miRNA Mature ID | miR-548t-5p | ||
|
miRNA Sequence |
CAAAAGUGAUCGUGGUUUUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 71 |
miR-5571 directly targets SLC7A11 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5571 | miRNA Mature ID | miR-5571-5p | ||
|
miRNA Sequence |
CAAUUCUCAAAGGAGCCUCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 72 |
miR-5589 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5589 | miRNA Mature ID | miR-5589-5p | ||
|
miRNA Sequence |
GGCUGGGUGCUCUUGUGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 73 |
miR-5589 directly targets SLC7A11 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5589 | miRNA Mature ID | miR-5589-3p | ||
|
miRNA Sequence |
UGCACAUGGCAACCUAGCUCCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 74 |
miR-5683 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5683 | miRNA Mature ID | miR-5683 | ||
|
miRNA Sequence |
UACAGAUGCAGAUUCUCUGACUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 75 |
miR-574 directly targets SLC7A11 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-574 | miRNA Mature ID | miR-574-5p | ||
|
miRNA Sequence |
UGAGUGUGUGUGUGUGAGUGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 76 |
miR-587 directly targets SLC7A11 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-587 | miRNA Mature ID | miR-587 | ||
|
miRNA Sequence |
UUUCCAUAGGUGAUGAGUCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 77 |
miR-595 directly targets SLC7A11 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-595 | miRNA Mature ID | miR-595 | ||
|
miRNA Sequence |
GAAGUGUGCCGUGGUGUGUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 78 |
miR-603 directly targets SLC7A11 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-603 | miRNA Mature ID | miR-603 | ||
|
miRNA Sequence |
CACACACUGCAAUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 79 |
miR-619 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-619 | miRNA Mature ID | miR-619-5p | ||
|
miRNA Sequence |
GCUGGGAUUACAGGCAUGAGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 80 |
miR-6504 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6504 | miRNA Mature ID | miR-6504-3p | ||
|
miRNA Sequence |
CAUUACAGCACAGCCAUUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 81 |
miR-6506 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6506 | miRNA Mature ID | miR-6506-5p | ||
|
miRNA Sequence |
ACUGGGAUGUCACUGAAUAUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 82 |
miR-6727 directly targets SLC7A11 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6727 | miRNA Mature ID | miR-6727-3p | ||
|
miRNA Sequence |
UCCUGCCACCUCCUCCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 83 |
miR-6747 directly targets SLC7A11 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6747 | miRNA Mature ID | miR-6747-3p | ||
|
miRNA Sequence |
UCCUGCCUUCCUCUGCACCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 84 |
miR-6778 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6778 | miRNA Mature ID | miR-6778-3p | ||
|
miRNA Sequence |
UGCCUCCCUGACAUUCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 85 |
miR-6791 directly targets SLC7A11 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6791 | miRNA Mature ID | miR-6791-3p | ||
|
miRNA Sequence |
UGCCUCCUUGGUCUCCGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 86 |
miR-6826 directly targets SLC7A11 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6826 | miRNA Mature ID | miR-6826-5p | ||
|
miRNA Sequence |
UCAAUAGGAAAGAGGUGGGACCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 87 |
miR-6829 directly targets SLC7A11 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6829 | miRNA Mature ID | miR-6829-3p | ||
|
miRNA Sequence |
UGCCUCCUCCGUGGCCUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 88 |
miR-6835 directly targets SLC7A11 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6835 | miRNA Mature ID | miR-6835-3p | ||
|
miRNA Sequence |
AAAAGCACUUUUCUGUCUCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 89 |
miR-6867 directly targets SLC7A11 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6867 | miRNA Mature ID | miR-6867-5p | ||
|
miRNA Sequence |
UGUGUGUGUAGAGGAAGAAGGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 90 |
miR-6874 directly targets SLC7A11 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6874 | miRNA Mature ID | miR-6874-5p | ||
|
miRNA Sequence |
AUGGAGCUGGAACCAGAUCAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 91 |
miR-767 directly targets SLC7A11 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-767 | miRNA Mature ID | miR-767-5p | ||
|
miRNA Sequence |
UGCACCAUGGUUGUCUGAGCAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 92 |
miR-8485 directly targets SLC7A11 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-8485 | miRNA Mature ID | miR-8485 | ||
|
miRNA Sequence |
CACACACACACACACACGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 93 |
miR-92a directly targets SLC7A11 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-92a | miRNA Mature ID | miR-92a-3p | ||
|
miRNA Sequence |
UAUUGCACUUGUCCCGGCCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 94 |
miR-92b directly targets SLC7A11 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-92b | miRNA Mature ID | miR-92b-3p | ||
|
miRNA Sequence |
UAUUGCACUCGUCCCGGCCUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 95 |
miR-93 directly targets SLC7A11 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-93 | miRNA Mature ID | miR-93-5p | ||
|
miRNA Sequence |
CAAAGUGCUGUUCGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.