Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0468 Transporter Info
Gene Name SLC7A2
Transporter Name Cationic amino acid transporter 2
Gene ID
6542
UniProt ID
P52569
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg03340398)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 1.63E-08; Z-score: -1.58E+00

Methylation in Case

 5.84E-01 (Median) Methylation in Control 7.08E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg09020665)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.40E+00 Statistic Test p-value: 1.59E-07; Z-score: -1.31E+00

Methylation in Case

 4.57E-01 (Median) Methylation in Control 6.40E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg11553245)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 3.36E-07; Z-score: -1.08E+00

Methylation in Case

 7.82E-01 (Median) Methylation in Control 8.70E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC7A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg23370213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.43E+00 Statistic Test p-value: 7.06E-06; Z-score: -9.08E-01

Methylation in Case

 1.64E-01 (Median) Methylation in Control 2.36E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Breast cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A2 in breast cancer [ 2 ]

Location

 5'UTR (cg11553245)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 3.14E-03; Z-score: 5.68E-01

Methylation in Case

 2.19E-01 (Median) Methylation in Control 1.98E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A2 in breast cancer [ 2 ]

Location

 5'UTR (cg03340398)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.76E-02; Z-score: 2.50E-01

Methylation in Case

 1.42E-01 (Median) Methylation in Control 1.32E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A2 in breast cancer [ 2 ]

Location

 TSS1500 (cg02207200)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 3.22E-05; Z-score: -8.87E-01

Methylation in Case

 1.61E-01 (Median) Methylation in Control 1.98E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC7A2 in breast cancer [ 2 ]

Location

 TSS1500 (cg24168914)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 4.08E-05; Z-score: 9.89E-01

Methylation in Case

 7.31E-02 (Median) Methylation in Control 5.50E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC7A2 in breast cancer [ 2 ]

Location

 TSS1500 (cg26199576)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 6.23E-04; Z-score: 4.30E-01

Methylation in Case

 1.17E-01 (Median) Methylation in Control 1.07E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A2 in clear cell renal cell carcinoma [ 3 ]

Location

 5'UTR (cg03340398)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 3.36E-03; Z-score: 4.31E-01

Methylation in Case

 1.25E-01 (Median) Methylation in Control 1.13E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A2 in clear cell renal cell carcinoma [ 3 ]

Location

 5'UTR (cg23370213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 6.11E-03; Z-score: 5.77E-01

Methylation in Case

 7.08E-02 (Median) Methylation in Control 5.63E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A2 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg26199576)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.34E+00 Statistic Test p-value: 2.69E-03; Z-score: 9.79E-01

Methylation in Case

 6.19E-02 (Median) Methylation in Control 4.61E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC7A2 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg24168914)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.56E+00 Statistic Test p-value: 7.81E-03; Z-score: 1.32E+00

Methylation in Case

 3.20E-02 (Median) Methylation in Control 2.05E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC7A2 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg02207200)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.07E+00 Statistic Test p-value: 2.40E-02; Z-score: -3.02E+00

Methylation in Case

 1.01E-01 (Median) Methylation in Control 3.10E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A2 in colorectal cancer [ 4 ]

Location

 5'UTR (cg09020665)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.38E+00 Statistic Test p-value: 3.88E-08; Z-score: 5.50E+00

Methylation in Case

 1.28E-01 (Median) Methylation in Control 5.39E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A2 in colorectal cancer [ 4 ]

Location

 5'UTR (cg23370213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.39E+00 Statistic Test p-value: 3.26E-07; Z-score: 1.65E+00

Methylation in Case

 2.91E-01 (Median) Methylation in Control 2.09E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A2 in colorectal cancer [ 4 ]

Location

 5'UTR (cg03340398)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 3.30E-03; Z-score: 1.16E-01

Methylation in Case

 1.42E-01 (Median) Methylation in Control 1.39E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC7A2 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg02207200)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.30E+00 Statistic Test p-value: 2.76E-02; Z-score: -6.36E-01

Methylation in Case

 1.74E-01 (Median) Methylation in Control 2.27E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A2 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg18827501)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.39E+00 Statistic Test p-value: 2.15E-15; Z-score: -3.43E+00

Methylation in Case

 5.50E-01 (Median) Methylation in Control 7.63E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A2 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg03340398)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 1.52E-03; Z-score: -4.76E-01

Methylation in Case

 1.14E-01 (Median) Methylation in Control 1.30E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A2 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg11553245)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 1.93E-03; Z-score: -5.03E-01

Methylation in Case

 1.98E-01 (Median) Methylation in Control 2.24E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC7A2 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg23370213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 1.47E-02; Z-score: -7.64E-01

Methylation in Case

 9.16E-02 (Median) Methylation in Control 1.15E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC7A2 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg26199576)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 8.69E-04; Z-score: -5.20E-01

Methylation in Case

 9.87E-02 (Median) Methylation in Control 1.13E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC7A2 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg24168914)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 2.74E-03; Z-score: -6.45E-01

Methylation in Case

 6.39E-02 (Median) Methylation in Control 8.27E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC7A2 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg01792749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.10E+00 Statistic Test p-value: 3.77E-24; Z-score: -4.31E+00

Methylation in Case

 2.61E-01 (Median) Methylation in Control 5.47E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC7A2 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg14241045)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.69E+00 Statistic Test p-value: 6.67E-18; Z-score: -5.15E+00

Methylation in Case

 3.05E-01 (Median) Methylation in Control 5.16E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC7A2 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg27580375)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.40E+00 Statistic Test p-value: 3.66E-14; Z-score: -8.46E+00

Methylation in Case

 6.01E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC7A2 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg06345767)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 1.05E-13; Z-score: -5.49E+00

Methylation in Case

 5.24E-01 (Median) Methylation in Control 7.02E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC7A2 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg00042186)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.51E+00 Statistic Test p-value: 1.49E-11; Z-score: 2.59E+00

Methylation in Case

 3.85E-01 (Median) Methylation in Control 2.56E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A2 in HIV infection [ 6 ]

Location

 5'UTR (cg09020665)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.60E+00 Statistic Test p-value: 8.51E-05; Z-score: 1.45E+00

Methylation in Case

 9.76E-02 (Median) Methylation in Control 6.12E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A2 in HIV infection [ 6 ]

Location

 5'UTR (cg03340398)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 7.81E-04; Z-score: 8.47E-01

Methylation in Case

 1.68E-01 (Median) Methylation in Control 1.43E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A2 in HIV infection [ 6 ]

Location

 5'UTR (cg23370213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 4.70E-03; Z-score: 9.51E-01

Methylation in Case

 1.55E-01 (Median) Methylation in Control 1.29E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC7A2 in HIV infection [ 6 ]

Location

 TSS1500 (cg24168914)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.75E+00 Statistic Test p-value: 8.17E-05; Z-score: 1.89E+00

Methylation in Case

 1.45E-01 (Median) Methylation in Control 8.30E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC7A2 in HIV infection [ 6 ]

Location

 TSS1500 (cg02207200)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.70E+00 Statistic Test p-value: 8.24E-05; Z-score: 2.21E+00

Methylation in Case

 1.63E-01 (Median) Methylation in Control 9.63E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC7A2 in HIV infection [ 6 ]

Location

 TSS1500 (cg26199576)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.41E+00 Statistic Test p-value: 5.02E-04; Z-score: 1.69E+00

Methylation in Case

 1.54E-01 (Median) Methylation in Control 1.09E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A2 in lung adenocarcinoma [ 7 ]

Location

 5'UTR (cg23370213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.59E+00 Statistic Test p-value: 1.29E-03; Z-score: 3.49E+00

Methylation in Case

 2.51E-01 (Median) Methylation in Control 1.58E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A2 in lung adenocarcinoma [ 7 ]

Location

 5'UTR (cg09020665)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.48E+00 Statistic Test p-value: 1.40E-02; Z-score: 2.62E+00

Methylation in Case

 1.30E-01 (Median) Methylation in Control 8.77E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A2 in lung adenocarcinoma [ 7 ]

Location

 5'UTR (cg03340398)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.42E+00 Statistic Test p-value: 1.58E-02; Z-score: 1.76E+00

Methylation in Case

 2.45E-01 (Median) Methylation in Control 1.73E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC7A2 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg02207200)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.37E+00 Statistic Test p-value: 4.55E-03; Z-score: 3.09E+00

Methylation in Case

 2.04E-01 (Median) Methylation in Control 1.48E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC7A2 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg24168914)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.39E+00 Statistic Test p-value: 9.46E-03; Z-score: 2.13E+00

Methylation in Case

 1.83E-01 (Median) Methylation in Control 1.32E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC7A2 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg26199576)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 2.97E-02; Z-score: 1.85E+00

Methylation in Case

 1.93E-01 (Median) Methylation in Control 1.45E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A2 in pancretic ductal adenocarcinoma [ 8 ]

Location

 5'UTR (cg10028227)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 1.18E-07; Z-score: 7.07E-01

Methylation in Case

 6.99E-02 (Median) Methylation in Control 5.63E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A2 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS200 (cg05845376)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.38E+00 Statistic Test p-value: 2.53E-05; Z-score: 1.09E+00

Methylation in Case

 7.00E-01 (Median) Methylation in Control 5.07E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A2 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg20489026)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 4.21E-04; Z-score: 4.16E-02

Methylation in Case

 4.24E-02 (Median) Methylation in Control 4.13E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC7A2 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg11799480)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 5.22E-03; Z-score: 5.98E-01

Methylation in Case

 5.14E-01 (Median) Methylation in Control 4.84E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC7A2 in pancretic ductal adenocarcinoma [ 8 ]

Location

 3'UTR (cg05867884)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 5.82E-08; Z-score: 1.25E+00

Methylation in Case

 4.45E-01 (Median) Methylation in Control 3.81E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A2 in papillary thyroid cancer [ 9 ]

Location

 5'UTR (cg11553245)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 8.69E-07; Z-score: -7.24E-01

Methylation in Case

 2.24E-01 (Median) Methylation in Control 2.71E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A2 in papillary thyroid cancer [ 9 ]

Location

 5'UTR (cg09020665)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 1.61E-03; Z-score: -6.67E-01

Methylation in Case

 8.94E-02 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A2 in papillary thyroid cancer [ 9 ]

Location

 5'UTR (cg23370213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 2.16E-02; Z-score: -4.44E-01

Methylation in Case

 7.96E-02 (Median) Methylation in Control 9.19E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC7A2 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg02207200)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.85E+00 Statistic Test p-value: 1.17E-15; Z-score: -2.55E+00

Methylation in Case

 1.21E-01 (Median) Methylation in Control 2.24E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A2 in systemic lupus erythematosus [ 10 ]

Location

 5'UTR (cg11553245)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.49E-02; Z-score: -1.74E-01

Methylation in Case

 3.87E-01 (Median) Methylation in Control 4.00E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A2 in bladder cancer [ 11 ]

Location

 TSS1500 (cg02207200)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.88E+00 Statistic Test p-value: 1.19E-06; Z-score: -5.87E+00

Methylation in Case

 6.91E-02 (Median) Methylation in Control 1.30E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Colon cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A2 in colon adenocarcinoma [ 12 ]

Location

 TSS200 (cg22907415)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 4.32E-04; Z-score: -3.49E+00

Methylation in Case

 5.47E-01 (Median) Methylation in Control 6.21E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A2 in colon adenocarcinoma [ 12 ]

Location

 TSS200 (cg04642741)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 5.47E-04; Z-score: 1.76E+00

Methylation in Case

 5.65E-01 (Median) Methylation in Control 4.50E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A2 in colon adenocarcinoma [ 12 ]

Location

 TSS200 (cg16164276)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.48E+00 Statistic Test p-value: 1.19E-03; Z-score: 1.31E+00

Methylation in Case

 3.28E-01 (Median) Methylation in Control 2.22E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC7A2 in colon adenocarcinoma [ 12 ]

Location

 Body (cg21591624)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 9.71E-04; Z-score: 1.84E+00

Methylation in Case

 4.36E-01 (Median) Methylation in Control 3.73E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC7A2 in colon adenocarcinoma [ 12 ]

Location

 Body (cg16520288)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.00E+00 Statistic Test p-value: 3.47E-03; Z-score: 1.60E+00

Methylation in Case

 1.66E-01 (Median) Methylation in Control 8.30E-02 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          45 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-101 directly targets SLC7A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-101 miRNA Mature ID miR-101-3p

miRNA Sequence

 UACAGUACUGUGAUAACUGAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-1206 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1206 miRNA Mature ID miR-1206

miRNA Sequence

 UGUUCAUGUAGAUGUUUAAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-1238 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1238 miRNA Mature ID miR-1238-5p

miRNA Sequence

 GUGAGUGGGAGCCCCAGUGUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-124 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-5p

miRNA Sequence

 CGUGUUCACAGCGGACCUUGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-144 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-144 miRNA Mature ID miR-144-3p

miRNA Sequence

 UACAGUAUAGAUGAUGUACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-188 directly targets SLC7A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-188 miRNA Mature ID miR-188-5p

miRNA Sequence

 CAUCCCUUGCAUGGUGGAGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-192 directly targets SLC7A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

 CUGACCUAUGAAUUGACAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-205 directly targets SLC7A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-205 miRNA Mature ID miR-205-5p

miRNA Sequence

 UCCUUCAUUCCACCGGAGUCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-24 directly targets SLC7A2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-24 miRNA Mature ID miR-24-3p

miRNA Sequence

 UGGCUCAGUUCAGCAGGAACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-27a directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-27a miRNA Mature ID miR-27a-3p

miRNA Sequence

 UUCACAGUGGCUAAGUUCCGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-27b directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-27b miRNA Mature ID miR-27b-3p

miRNA Sequence

 UUCACAGUGGCUAAGUUCUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-29b-2 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-29b-2 miRNA Mature ID miR-29b-2-5p

miRNA Sequence

 CUGGUUUCACAUGGUGGCUUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-30c-2 directly targets SLC7A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-30c-2 miRNA Mature ID miR-30c-2-3p

miRNA Sequence

 CUGGGAGAAGGCUGUUUACUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 14

 miR-3117 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3117 miRNA Mature ID miR-3117-3p

miRNA Sequence

 AUAGGACUCAUAUAGUGCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-3120 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3120 miRNA Mature ID miR-3120-3p

miRNA Sequence

 CACAGCAAGUGUAGACAGGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-3124 directly targets SLC7A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3124 miRNA Mature ID miR-3124-3p

miRNA Sequence

 ACUUUCCUCACUCCCGUGAAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-3659 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3659 miRNA Mature ID miR-3659

miRNA Sequence

 UGAGUGUUGUCUACGAGGGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 18

 miR-3680 directly targets SLC7A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3680 miRNA Mature ID miR-3680-3p

miRNA Sequence

 UUUUGCAUGACCCUGGGAGUAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-410 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-410 miRNA Mature ID miR-410-3p

miRNA Sequence

 AAUAUAACACAGAUGGCCUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 20

 miR-423 directly targets SLC7A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-423 miRNA Mature ID miR-423-5p

miRNA Sequence

 UGAGGGGCAGAGAGCGAGACUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 21

 miR-4255 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4255 miRNA Mature ID miR-4255

miRNA Sequence

 CAGUGUUCAGAGAUGGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

 miR-4446 directly targets SLC7A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4446 miRNA Mature ID miR-4446-5p

miRNA Sequence

 AUUUCCCUGCCAUUCCCUUGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-452 directly targets SLC7A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-452 miRNA Mature ID miR-452-3p

miRNA Sequence

 CUCAUCUGCAAAGAAGUAAGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-4658 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4658 miRNA Mature ID miR-4658

miRNA Sequence

 GUGAGUGUGGAUCCUGGAGGAAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 25

 miR-4666b directly targets SLC7A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4666b miRNA Mature ID miR-4666b

miRNA Sequence

 UUGCAUGUCAGAUUGUAAUUCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-4755 directly targets SLC7A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4755 miRNA Mature ID miR-4755-5p

miRNA Sequence

 UUUCCCUUCAGAGCCUGGCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-4758 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4758 miRNA Mature ID miR-4758-5p

miRNA Sequence

 GUGAGUGGGAGCCGGUGGGGCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 28

 miR-499a directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-499a miRNA Mature ID miR-499a-3p

miRNA Sequence

 AACAUCACAGCAAGUCUGUGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 29

 miR-5006 directly targets SLC7A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5006 miRNA Mature ID miR-5006-3p

miRNA Sequence

 UUUCCCUUUCCAUCCUGGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-5007 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5007 miRNA Mature ID miR-5007-3p

miRNA Sequence

 AUCAUAUGAACCAAACUCUAAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 31

 miR-5011 directly targets SLC7A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5011 miRNA Mature ID miR-5011-3p

miRNA Sequence

 GUGCAUGGCUGUAUAUAUAACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-513a directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-513a miRNA Mature ID miR-513a-5p

miRNA Sequence

 UUCACAGGGAGGUGUCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 33

 miR-545 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-545 miRNA Mature ID miR-545-5p

miRNA Sequence

 UCAGUAAAUGUUUAUUAGAUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 34

 miR-574 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-574 miRNA Mature ID miR-574-5p

miRNA Sequence

 UGAGUGUGUGUGUGUGAGUGUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 35

 miR-582 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-582 miRNA Mature ID miR-582-5p

miRNA Sequence

 UUACAGUUGUUCAACCAGUUACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 36

 miR-598 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-598 miRNA Mature ID miR-598-3p

miRNA Sequence

 UACGUCAUCGUUGUCAUCGUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 37

 miR-615 directly targets SLC7A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-615 miRNA Mature ID miR-615-3p

miRNA Sequence

 UCCGAGCCUGGGUCUCCCUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 38

 miR-651 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-651 miRNA Mature ID miR-651-5p

miRNA Sequence

 UUUAGGAUAAGCUUGACUUUUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 39

 miR-6790 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6790 miRNA Mature ID miR-6790-5p

miRNA Sequence

 GUGAGUGUGGAUUUGGCGGGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 40

 miR-6790 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6790 miRNA Mature ID miR-6790-3p

miRNA Sequence

 CGACCUCGGCGACCCCUCACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 41

 miR-6853 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6853 miRNA Mature ID miR-6853-3p

miRNA Sequence

 UGUUCAUUGGAACCCUGCGCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 42

 miR-6866 directly targets SLC7A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6866 miRNA Mature ID miR-6866-3p

miRNA Sequence

 GAUCCCUUUAUCUGUCCUCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 43

 miR-7849 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7849 miRNA Mature ID miR-7849-3p

miRNA Sequence

 GACAAUUGUUGAUCUUGGGCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 44

 miR-8081 directly targets SLC7A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-8081 miRNA Mature ID miR-8081

miRNA Sequence

 CUUGAGUCGUGCCUUUCUGAAUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 45

 miR-9 directly targets SLC7A2 [ 19 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-9 miRNA Mature ID miR-9-5p

miRNA Sequence

 UCUUUGGUUAUCUAGCUGUAUGA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11 DNA Methylation Dynamics in Urological Tumors.
12 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
13 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
14 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
16 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
17 miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Mol Cell. 2009 Sep 11;35(5):610-25.
18 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
19 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.