Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0473 Transporter Info
Gene Name SLC7A6
Transporter Name Y+L amino acid transporter 2
Gene ID
9057
UniProt ID
Q92536
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-125b directly targets SLC7A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-125b miRNA Mature ID miR-125b-5p

miRNA Sequence

 UCCCUGAGACCCUAACUUGUGA

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 miR-193b directly targets SLC7A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-193b miRNA Mature ID miR-193b-3p

miRNA Sequence

 AACUGGCCCUCAAAGUCCCGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-30a directly targets SLC7A6 [ 3 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay//qRT-PCR//Western blot

miRNA Stemloop ID

 miR-30a miRNA Mature ID miR-30a-3p

miRNA Sequence

 CUUUCAGUCGGAUGUUUGCAGC

miRNA Target Type

 Direct

Experimental Material

 Human liver hepatocellular carcinoma cell line (HepG2)

  Epigenetic Phenomenon 4

 miR-98 directly targets SLC7A6 [ 4 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

 UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

Methylation
References
1 Widespread deregulation of microRNA expression in human prostate cancer. Oncogene. 2008 Mar 13;27(12):1788-93.
2 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
3 Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
4 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.