Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0475 Transporter Info
Gene Name SLC7A8
Transporter Name L-type amino acid transporter 2
Gene ID
23428
UniProt ID
Q9UHI5
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A8 in bladder cancer [ 1 ]

Location

 TSS1500 (cg23099740)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 2.41E-04; Z-score: -2.04E+00

Methylation in Case

 6.10E-01 (Median) Methylation in Control 6.84E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A8 in bladder cancer [ 1 ]

Location

 Body (cg15527515)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.66E+00 Statistic Test p-value: 3.96E-08; Z-score: -7.01E+00

Methylation in Case

 2.27E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A8 in bladder cancer [ 1 ]

Location

 Body (cg01746503)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 7.60E-05; Z-score: -4.96E+00

Methylation in Case

 7.66E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A8 in breast cancer [ 2 ]

Location

 TSS1500 (cg23099740)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 2.71E-03; Z-score: -9.83E-01

Methylation in Case

 6.01E-01 (Median) Methylation in Control 6.96E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A8 in breast cancer [ 2 ]

Location

 TSS1500 (cg27035169)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 3.87E-03; Z-score: 8.15E-01

Methylation in Case

 3.36E-01 (Median) Methylation in Control 2.72E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A8 in breast cancer [ 2 ]

Location

 TSS200 (cg13052102)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.30E+00 Statistic Test p-value: 7.33E-05; Z-score: 5.51E-01

Methylation in Case

 4.04E-02 (Median) Methylation in Control 3.12E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC7A8 in breast cancer [ 2 ]

Location

 Body (cg01746503)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.03E-03; Z-score: -4.47E-01

Methylation in Case

 8.10E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A8 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg23099740)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.40E-02; Z-score: -8.26E-01

Methylation in Case

 8.43E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A8 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg27035169)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 2.21E-02; Z-score: 4.38E-01

Methylation in Case

 3.73E-01 (Median) Methylation in Control 3.44E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A8 in colorectal cancer [ 3 ]

Location

 TSS200 (cg13052102)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 8.38E-03; Z-score: 3.23E-01

Methylation in Case

 2.82E-02 (Median) Methylation in Control 2.59E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC7A8 in colorectal cancer [ 3 ]

Location

 Body (cg15527515)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 7.47E-04; Z-score: -6.74E-01

Methylation in Case

 8.25E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A8 in HIV infection [ 4 ]

Location

 TSS1500 (cg27035169)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 6.95E-06; Z-score: 1.35E+00

Methylation in Case

 5.14E-01 (Median) Methylation in Control 3.97E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A8 in HIV infection [ 4 ]

Location

 TSS200 (cg13052102)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.64E+00 Statistic Test p-value: 8.94E-04; Z-score: 1.51E+00

Methylation in Case

 3.25E-02 (Median) Methylation in Control 1.98E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A8 in HIV infection [ 4 ]

Location

 Body (cg15527515)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.72E+00 Statistic Test p-value: 9.32E-10; Z-score: 3.69E+00

Methylation in Case

 6.49E-01 (Median) Methylation in Control 3.77E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A8 in lung adenocarcinoma [ 5 ]

Location

 TSS1500 (cg27035169)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 8.22E-03; Z-score: 1.36E+00

Methylation in Case

 4.50E-01 (Median) Methylation in Control 3.78E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A8 in pancretic ductal adenocarcinoma [ 6 ]

Location

 TSS1500 (cg16525281)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 3.70E-07; Z-score: -1.61E+00

Methylation in Case

 1.60E-01 (Median) Methylation in Control 2.04E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A8 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg17497176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 6.52E-05; Z-score: 9.36E-01

Methylation in Case

 7.95E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC7A8 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg07765706)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 3.28E-04; Z-score: -1.04E-01

Methylation in Case

 9.30E-01 (Median) Methylation in Control 9.31E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC7A8 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg08244301)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 6.66E-04; Z-score: -7.67E-01

Methylation in Case

 6.68E-01 (Median) Methylation in Control 7.41E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A8 in hepatocellular carcinoma [ 7 ]

Location

 TSS200 (cg13052102)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 5.89E-03; Z-score: -1.23E-01

Methylation in Case

 4.20E-02 (Median) Methylation in Control 4.45E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC7A8 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg14463790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.61E+00 Statistic Test p-value: 7.07E-16; Z-score: -3.35E+00

Methylation in Case

 3.57E-01 (Median) Methylation in Control 5.76E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A8 in atypical teratoid rhabdoid tumor [ 8 ]

Location

 Body (cg01746503)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 7.95E-05; Z-score: -5.65E-01

Methylation in Case

 1.87E-01 (Median) Methylation in Control 2.42E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC7A8 in panic disorder [ 9 ]

Location

 Body (cg15527515)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -8.65E-01 Statistic Test p-value: 3.34E-02; Z-score: -2.97E-01

Methylation in Case

 -1.38E+00 (Median) Methylation in Control -1.19E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Liver cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate/moderate hypomethylation of SLC7A8 in liver cancer than that in healthy individual/adjacent tissue

Studied Phenotype

 Liver cancer [ICD-11:2C12]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 2.82E-10; Fold-change: -0.297461433; Z-score: -2.261557287

The Methylation Level of Disease Section Compare with the Adjacent Tissue

 p-value: 3.14E-15; Fold-change: -0.282879896; Z-score: -9.772957779
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section
Download DT methylation data in the tissue of healthy individual
Download DT methylation data in the tissue of the other disease section

  Brain neuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC7A8 in brain neuroblastoma than that in healthy individual

Studied Phenotype

 Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.13E-14; Fold-change: -0.382798035; Z-score: -10.68283264
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Multilayered rosettes embryonal tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC7A8 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

 Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 4.18E-33; Fold-change: -0.685564297; Z-score: -19.2657032
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-185 directly targets SLC7A8 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-185 miRNA Mature ID miR-185-5p

miRNA Sequence

 UGGAGAGAAAGGCAGUUCCUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-4306 directly targets SLC7A8 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4306 miRNA Mature ID miR-4306

miRNA Sequence

 UGGAGAGAAAGGCAGUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-4428 directly targets SLC7A8 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4428 miRNA Mature ID miR-4428

miRNA Sequence

 CAAGGAGACGGGAACAUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-4644 directly targets SLC7A8 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4644 miRNA Mature ID miR-4644

miRNA Sequence

 UGGAGAGAGAAAAGAGACAGAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
5 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
6 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
9 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.