Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0477 Transporter Info
Gene Name	SLC8A1
Transporter Name	Sodium/calcium exchanger 1
Gene ID	6546
UniProt ID	P32418

Epigenetic Regulations of This DT (EGR)
Methylation
Bladder cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC8A1 in bladder cancer			[ 1 ]
Location	5'UTR (cg03256780)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.55E+00	Statistic Test	p-value: 4.33E-07; Z-score: -5.36E+00
Methylation in Case	1.63E-01 (Median)	Methylation in Control	4.15E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC8A1 in bladder cancer			[ 1 ]
Location	5'UTR (cg08240652)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 6.63E-05; Z-score: -1.07E+01
Methylation in Case	7.87E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC8A1 in bladder cancer			[ 1 ]
Location	5'UTR (cg15549810)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 5.48E-04; Z-score: -3.13E+00
Methylation in Case	7.11E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC8A1 in bladder cancer			[ 1 ]
Location	5'UTR (cg19918022)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 2.40E-03; Z-score: -3.80E+00
Methylation in Case	7.89E-01 (Median)	Methylation in Control	8.58E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC8A1 in bladder cancer			[ 1 ]
Location	5'UTR (cg00610991)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.77E+00	Statistic Test	p-value: 3.99E-03; Z-score: -3.92E+00
Methylation in Case	1.29E-01 (Median)	Methylation in Control	2.29E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC8A1 in bladder cancer			[ 1 ]
Location	5'UTR (cg10633958)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 7.71E-03; Z-score: 1.68E+00
Methylation in Case	9.48E-02 (Median)	Methylation in Control	7.69E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC8A1 in bladder cancer			[ 1 ]
Location	TSS1500 (cg02870829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.61E+00	Statistic Test	p-value: 3.83E-08; Z-score: -6.80E+00
Methylation in Case	4.26E-01 (Median)	Methylation in Control	6.87E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC8A1 in bladder cancer			[ 1 ]
Location	TSS1500 (cg02577240)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 8.50E-04; Z-score: -3.79E+00
Methylation in Case	5.95E-01 (Median)	Methylation in Control	8.04E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC8A1 in bladder cancer			[ 1 ]
Location	TSS200 (cg24396429)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.84E+00	Statistic Test	p-value: 1.20E-09; Z-score: 1.03E+01
Methylation in Case	7.21E-01 (Median)	Methylation in Control	3.92E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	17 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg00610991)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.93E+00	Statistic Test	p-value: 9.67E-17; Z-score: 3.48E+00
Methylation in Case	3.51E-01 (Median)	Methylation in Control	1.82E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg03256780)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.83E+00	Statistic Test	p-value: 1.34E-15; Z-score: -2.39E+00
Methylation in Case	2.46E-01 (Median)	Methylation in Control	4.50E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg15549810)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 8.24E-12; Z-score: -2.45E+00
Methylation in Case	7.10E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg10633958)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.88E+00	Statistic Test	p-value: 8.26E-10; Z-score: 2.78E+00
Methylation in Case	1.24E-01 (Median)	Methylation in Control	6.57E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg14411266)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.15E+00	Statistic Test	p-value: 1.69E-07; Z-score: 1.27E+00
Methylation in Case	9.18E-02 (Median)	Methylation in Control	4.27E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg23601376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.43E+00	Statistic Test	p-value: 2.53E-07; Z-score: 1.48E+00
Methylation in Case	8.23E-02 (Median)	Methylation in Control	5.74E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg12748607)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 2.67E-07; Z-score: 1.19E+00
Methylation in Case	7.58E-02 (Median)	Methylation in Control	5.97E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg08240652)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 4.20E-06; Z-score: -1.71E+00
Methylation in Case	8.30E-01 (Median)	Methylation in Control	8.88E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg12742937)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 5.36E-06; Z-score: 6.90E-01
Methylation in Case	1.84E-01 (Median)	Methylation in Control	1.61E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg03307465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 7.55E-06; Z-score: 5.03E-01
Methylation in Case	3.82E-02 (Median)	Methylation in Control	2.87E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg09021626)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 6.85E-05; Z-score: 9.93E-01
Methylation in Case	1.04E-01 (Median)	Methylation in Control	8.40E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg20227806)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 2.89E-04; Z-score: 7.06E-01
Methylation in Case	8.03E-02 (Median)	Methylation in Control	7.00E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg19918022)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 4.67E-04; Z-score: -6.17E-01
Methylation in Case	8.47E-01 (Median)	Methylation in Control	8.72E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	5'UTR (cg14686012)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 2.14E-02; Z-score: 2.87E-01
Methylation in Case	7.91E-02 (Median)	Methylation in Control	7.25E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	TSS1500 (cg02870829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 6.57E-13; Z-score: -2.45E+00
Methylation in Case	7.23E-01 (Median)	Methylation in Control	8.27E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	TSS1500 (cg02577240)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 8.05E-11; Z-score: -1.96E+00
Methylation in Case	8.20E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of SLC8A1 in breast cancer			[ 2 ]
Location	TSS200 (cg24396429)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.39E+00	Statistic Test	p-value: 3.08E-18; Z-score: 2.53E+00
Methylation in Case	6.66E-01 (Median)	Methylation in Control	4.78E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC8A1 in clear cell renal cell carcinoma			[ 3 ]
Location	5'UTR (cg14411266)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.52E+00	Statistic Test	p-value: 1.10E-04; Z-score: 2.26E+00
Methylation in Case	3.78E-02 (Median)	Methylation in Control	2.48E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC8A1 in clear cell renal cell carcinoma			[ 3 ]
Location	5'UTR (cg09021626)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 9.50E-03; Z-score: 6.39E-01
Methylation in Case	5.08E-02 (Median)	Methylation in Control	4.30E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC8A1 in clear cell renal cell carcinoma			[ 3 ]
Location	5'UTR (cg12748607)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 1.20E-02; Z-score: 5.18E-01
Methylation in Case	2.55E-02 (Median)	Methylation in Control	2.22E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC8A1 in clear cell renal cell carcinoma			[ 3 ]
Location	5'UTR (cg23601376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 2.13E-02; Z-score: 7.00E-01
Methylation in Case	2.42E-02 (Median)	Methylation in Control	2.03E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC8A1 in clear cell renal cell carcinoma			[ 3 ]
Location	5'UTR (cg14686012)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 2.14E-02; Z-score: 3.72E-01
Methylation in Case	3.63E-02 (Median)	Methylation in Control	3.33E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC8A1 in clear cell renal cell carcinoma			[ 3 ]
Location	5'UTR (cg03307465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 4.89E-02; Z-score: 2.71E-01
Methylation in Case	1.92E-02 (Median)	Methylation in Control	1.81E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg14686012)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.11E+00	Statistic Test	p-value: 1.24E-18; Z-score: 6.72E+00
Methylation in Case	5.42E-01 (Median)	Methylation in Control	1.74E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg03307465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.24E+00	Statistic Test	p-value: 1.74E-18; Z-score: 4.14E+00
Methylation in Case	4.94E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg09021626)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.02E+00	Statistic Test	p-value: 2.65E-17; Z-score: 4.86E+00
Methylation in Case	6.70E-01 (Median)	Methylation in Control	2.22E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg20227806)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.30E+00	Statistic Test	p-value: 6.73E-15; Z-score: 3.42E+00
Methylation in Case	5.58E-01 (Median)	Methylation in Control	2.42E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg14411266)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.03E+00	Statistic Test	p-value: 9.46E-14; Z-score: 2.92E+00
Methylation in Case	4.26E-01 (Median)	Methylation in Control	1.40E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg12748607)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.96E+00	Statistic Test	p-value: 2.31E-12; Z-score: 2.34E+00
Methylation in Case	5.90E-01 (Median)	Methylation in Control	3.01E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg12742937)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.57E+00	Statistic Test	p-value: 1.41E-10; Z-score: 2.76E+00
Methylation in Case	7.76E-01 (Median)	Methylation in Control	4.95E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg08240652)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 8.93E-10; Z-score: -3.49E+00
Methylation in Case	8.45E-01 (Median)	Methylation in Control	9.27E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg15549810)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 6.06E-09; Z-score: -2.64E+00
Methylation in Case	6.44E-01 (Median)	Methylation in Control	7.68E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg03256780)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 2.67E-07; Z-score: -1.78E+00
Methylation in Case	4.03E-01 (Median)	Methylation in Control	5.06E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg19918022)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.30E-05; Z-score: -2.53E+00
Methylation in Case	9.01E-01 (Median)	Methylation in Control	9.24E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg10633958)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 1.31E-04; Z-score: 1.13E+00
Methylation in Case	4.55E-01 (Median)	Methylation in Control	3.42E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg00610991)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 5.05E-03; Z-score: 9.53E-01
Methylation in Case	6.46E-01 (Median)	Methylation in Control	5.53E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg02870829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 2.29E-05; Z-score: -9.79E-01
Methylation in Case	7.53E-01 (Median)	Methylation in Control	8.29E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg02577240)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 6.74E-05; Z-score: -8.00E-01
Methylation in Case	7.58E-01 (Median)	Methylation in Control	8.15E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC8A1 in colorectal cancer			[ 4 ]
Location	TSS200 (cg13167631)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 1.51E-04; Z-score: -1.11E+00
Methylation in Case	6.41E-01 (Median)	Methylation in Control	7.95E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC8A1 in hepatocellular carcinoma			[ 5 ]
Location	5'UTR (cg00610991)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.74E+00	Statistic Test	p-value: 1.19E-07; Z-score: -2.66E+00
Methylation in Case	1.92E-01 (Median)	Methylation in Control	3.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC8A1 in hepatocellular carcinoma			[ 5 ]
Location	5'UTR (cg03307465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.51E+00	Statistic Test	p-value: 4.17E-06; Z-score: 1.16E+00
Methylation in Case	4.74E-02 (Median)	Methylation in Control	3.14E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC8A1 in hepatocellular carcinoma			[ 5 ]
Location	5'UTR (cg23601376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 6.32E-04; Z-score: -6.80E-01
Methylation in Case	5.89E-02 (Median)	Methylation in Control	7.99E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC8A1 in hepatocellular carcinoma			[ 5 ]
Location	5'UTR (cg09021626)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 1.26E-03; Z-score: 5.37E-01
Methylation in Case	1.53E-01 (Median)	Methylation in Control	1.37E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC8A1 in hepatocellular carcinoma			[ 5 ]
Location	5'UTR (cg20227806)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.30E-03; Z-score: -3.52E-02
Methylation in Case	9.28E-02 (Median)	Methylation in Control	9.33E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC8A1 in hepatocellular carcinoma			[ 5 ]
Location	5'UTR (cg14686012)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 1.46E-03; Z-score: 1.67E-02
Methylation in Case	8.49E-02 (Median)	Methylation in Control	8.47E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC8A1 in hepatocellular carcinoma			[ 5 ]
Location	5'UTR (cg12748607)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 9.16E-03; Z-score: -3.75E-01
Methylation in Case	7.14E-02 (Median)	Methylation in Control	7.74E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC8A1 in hepatocellular carcinoma			[ 5 ]
Location	5'UTR (cg12742937)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.03E-02; Z-score: -2.44E-02
Methylation in Case	1.60E-01 (Median)	Methylation in Control	1.61E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC8A1 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg13913015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.56E+00	Statistic Test	p-value: 1.03E-09; Z-score: 4.92E+00
Methylation in Case	1.49E-01 (Median)	Methylation in Control	4.18E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC8A1 in hepatocellular carcinoma			[ 5 ]
Location	1stExon (cg15668691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 1.55E-13; Z-score: -7.42E+00
Methylation in Case	6.19E-01 (Median)	Methylation in Control	8.50E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC8A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg18563642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.51E+00	Statistic Test	p-value: 4.88E-16; Z-score: -3.28E+00
Methylation in Case	3.69E-01 (Median)	Methylation in Control	5.57E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC8A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg27382405)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.71E+00	Statistic Test	p-value: 2.63E-14; Z-score: 2.25E+00
Methylation in Case	5.16E-01 (Median)	Methylation in Control	3.01E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC8A1 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg24369466)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 1.36E-11; Z-score: -4.53E+00
Methylation in Case	8.15E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC8A1 in lung adenocarcinoma			[ 6 ]
Location	5'UTR (cg03307465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.99E+00	Statistic Test	p-value: 7.71E-03; Z-score: 1.27E+01
Methylation in Case	1.75E-01 (Median)	Methylation in Control	4.38E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC8A1 in lung adenocarcinoma			[ 6 ]
Location	5'UTR (cg10633958)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 1.33E-02; Z-score: 2.42E+00
Methylation in Case	1.67E-01 (Median)	Methylation in Control	1.19E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC8A1 in lung adenocarcinoma			[ 6 ]
Location	5'UTR (cg14411266)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.14E+00	Statistic Test	p-value: 1.69E-02; Z-score: 5.21E+00
Methylation in Case	1.82E-01 (Median)	Methylation in Control	8.50E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC8A1 in lung adenocarcinoma			[ 6 ]
Location	5'UTR (cg09021626)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 2.91E-02; Z-score: 1.70E+00
Methylation in Case	1.64E-01 (Median)	Methylation in Control	1.33E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC8A1 in lung adenocarcinoma			[ 6 ]
Location	5'UTR (cg19918022)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.77E-02; Z-score: -1.49E+00
Methylation in Case	8.67E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC8A1 in papillary thyroid cancer			[ 7 ]
Location	5'UTR (cg08240652)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 8.42E-05; Z-score: -6.27E-01
Methylation in Case	9.05E-01 (Median)	Methylation in Control	9.21E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC8A1 in papillary thyroid cancer			[ 7 ]
Location	5'UTR (cg03256780)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 1.13E-02; Z-score: -7.04E-01
Methylation in Case	3.16E-01 (Median)	Methylation in Control	3.58E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC8A1 in papillary thyroid cancer			[ 7 ]
Location	5'UTR (cg19918022)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.39E-02; Z-score: -2.89E-01
Methylation in Case	9.25E-01 (Median)	Methylation in Control	9.30E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC8A1 in papillary thyroid cancer			[ 7 ]
Location	TSS1500 (cg02577240)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 9.95E-03; Z-score: -3.53E-01
Methylation in Case	9.31E-01 (Median)	Methylation in Control	9.36E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC8A1 in papillary thyroid cancer			[ 7 ]
Location	TSS1500 (cg02870829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.32E-02; Z-score: -2.72E-01
Methylation in Case	8.99E-01 (Median)	Methylation in Control	9.06E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC8A1 in papillary thyroid cancer			[ 7 ]
Location	TSS200 (cg24396429)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.24E-06; Z-score: 1.08E+00
Methylation in Case	7.57E-01 (Median)	Methylation in Control	6.92E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC8A1 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS1500 (cg27485921)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 8.24E-10; Z-score: -1.87E+00
Methylation in Case	4.60E-01 (Median)	Methylation in Control	5.86E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC8A1 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg27569822)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 3.16E-07; Z-score: 1.02E+00
Methylation in Case	6.87E-02 (Median)	Methylation in Control	5.85E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC8A1 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg11666857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 3.24E-22; Z-score: -3.38E+00
Methylation in Case	6.60E-01 (Median)	Methylation in Control	8.03E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC8A1 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.88E+00	Statistic Test	p-value: 2.26E-19; Z-score: 2.96E+00
Methylation in Case	3.17E-01 (Median)	Methylation in Control	1.69E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC8A1 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg24454829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 8.62E-19; Z-score: 2.89E+00
Methylation in Case	4.36E-01 (Median)	Methylation in Control	3.26E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC8A1 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg05978154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 1.22E-10; Z-score: -1.79E+00
Methylation in Case	6.89E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC8A1 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg06094523)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 3.55E-10; Z-score: -1.47E+00
Methylation in Case	3.97E-01 (Median)	Methylation in Control	5.29E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC8A1 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg05169099)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 6.71E-06; Z-score: 1.25E+00
Methylation in Case	7.99E-01 (Median)	Methylation in Control	7.07E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC8A1 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg00718541)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.44E-05; Z-score: 8.11E-01
Methylation in Case	9.06E-01 (Median)	Methylation in Control	8.79E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC8A1 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg09691393)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 7.04E-03; Z-score: 8.12E-01
Methylation in Case	8.58E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC8A1 in panic disorder			[ 9 ]
Location	TSS1500 (cg02870829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -3.18E+00	Statistic Test	p-value: 1.99E-04; Z-score: -5.91E-01
Methylation in Case	1.20E-01 (Median)	Methylation in Control	3.83E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Colon cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC8A1 in colon adenocarcinoma			[ 10 ]
Location	Body (cg07546508)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 3.30E-05; Z-score: -1.88E+00
Methylation in Case	5.76E-01 (Median)	Methylation in Control	6.57E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC8A1 in colon adenocarcinoma			[ 10 ]
Location	Body (cg06728970)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.44E-03; Z-score: -1.22E+00
Methylation in Case	4.95E-01 (Median)	Methylation in Control	5.64E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC8A1 in colon adenocarcinoma			[ 10 ]
Location	Body (cg24948829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.83E-03; Z-score: -1.57E+00
Methylation in Case	7.46E-01 (Median)	Methylation in Control	7.76E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC8A1 in colon adenocarcinoma			[ 10 ]
Location	Body (cg15647725)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.21E-03; Z-score: 9.76E-01
Methylation in Case	6.22E-01 (Median)	Methylation in Control	5.94E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC8A1 in colon adenocarcinoma			[ 10 ]
Location	Body (cg19272348)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 3.22E-03; Z-score: -1.69E+00
Methylation in Case	4.91E-01 (Median)	Methylation in Control	5.78E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Prostate cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC8A1 in prostate cancer			[ 11 ]
Location	Body (cg04204452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 1.58E-03; Z-score: 3.92E+00
Methylation in Case	8.49E-01 (Median)	Methylation in Control	6.61E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC8A1 in prostate cancer			[ 11 ]
Location	Body (cg23707719)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 5.35E-03; Z-score: 8.83E+00
Methylation in Case	8.48E-01 (Median)	Methylation in Control	6.27E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC8A1 in prostate cancer			[ 11 ]
Location	Body (cg00704369)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 8.12E-03; Z-score: 2.85E+00
Methylation in Case	9.27E-01 (Median)	Methylation in Control	8.47E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC8A1 in prostate cancer			[ 11 ]
Location	Body (cg02057782)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.58E+00	Statistic Test	p-value: 1.33E-02; Z-score: 1.11E+01
Methylation in Case	6.44E-01 (Median)	Methylation in Control	4.08E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC8A1 in prostate cancer			[ 11 ]
Location	Body (cg24724513)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.78E+00	Statistic Test	p-value: 1.72E-02; Z-score: -7.82E+00
Methylation in Case	4.37E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC8A1 in prostate cancer			[ 11 ]
Location	3'UTR (cg08203794)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 6.52E-03; Z-score: 2.93E+00
Methylation in Case	8.91E-01 (Median)	Methylation in Control	8.50E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC8A1 in prostate cancer			[ 11 ]
Location	3'UTR (cg05174446)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 2.24E-02; Z-score: 2.96E+00
Methylation in Case	8.81E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC8A1 in prostate cancer			[ 11 ]
Location	3'UTR (cg08241225)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 2.95E-02; Z-score: 1.52E+00
Methylation in Case	9.03E-01 (Median)	Methylation in Control	8.32E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC8A1 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.004129274; Fold-change: 0.255889435; Z-score: 0.916987402
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC8A1 in melanocytoma than that in healthy individual
Studied Phenotype	Melanocytoma [ICD-11:2F36.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 6.15E-06; Fold-change: 0.378751745; Z-score: 1.427249903
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Myxopapillary ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC8A1 in myxopapillary ependymoma than that in healthy individual
Studied Phenotype	Myxopapillary ependymoma [ICD-11:2A00.5]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.015285926; Fold-change: 0.310090744; Z-score: 1.16535805
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Peripheral neuroectodermal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC8A1 in peripheral neuroectodermal tumour than that in healthy individual
Studied Phenotype	Peripheral neuroectodermal tumour [ICD-11:2B52]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.06E-07; Fold-change: 0.370115587; Z-score: 1.361646643
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Craniopharyngioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC8A1 in craniopharyngioma than that in healthy individual
Studied Phenotype	Craniopharyngioma [ICD-11:2F9A]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 6.99E-08; Fold-change: -0.341285526; Z-score: -14.64442798
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Posterior fossa ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC8A1 in posterior fossa ependymoma than that in healthy individual
Studied Phenotype	Posterior fossa ependymoma [ICD-11:2D50.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.14E-37; Fold-change: -0.43152921; Z-score: -1.970444783
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	42 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1305 directly targets SLC8A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1305	miRNA Mature ID	miR-1305
miRNA Sequence	UUUUCAACUCUAAUGGGAGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-146a directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-146a	miRNA Mature ID	miR-146a-3p
miRNA Sequence	CCUCUGAAAUUCAGUUCUUCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 3	miR-1825 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1825	miRNA Mature ID	miR-1825
miRNA Sequence	UCCAGUGCCCUCCUCUCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 4	miR-190a directly targets SLC8A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP//HITS-CLIP
miRNA Stemloop ID	miR-190a	miRNA Mature ID	miR-190a-3p
miRNA Sequence	CUAUAUAUCAAACAUAUUCCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 5	miR-199a directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-199a	miRNA Mature ID	miR-199a-5p
miRNA Sequence	CCCAGUGUUCAGACUACCUGUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 6	miR-199b directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-199b	miRNA Mature ID	miR-199b-5p
miRNA Sequence	CCCAGUGUUUAGACUAUCUGUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 7	miR-3135a directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3135a	miRNA Mature ID	miR-3135a
miRNA Sequence	UGCCUAGGCUGAGACUGCAGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 8	miR-3148 directly targets SLC8A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3148	miRNA Mature ID	miR-3148
miRNA Sequence	UGGAAAAAACUGGUGUGUGCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-3150b directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3150b	miRNA Mature ID	miR-3150b-3p
miRNA Sequence	UGAGGAGAUCGUCGAGGUUGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 10	miR-3161 directly targets SLC8A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3161	miRNA Mature ID	miR-3161
miRNA Sequence	CUGAUAAGAACAGAGGCCCAGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-3606 directly targets SLC8A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3606	miRNA Mature ID	miR-3606-3p
miRNA Sequence	AAAAUUUCUUUCACUACUUAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 12	miR-3622a directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3622a	miRNA Mature ID	miR-3622a-5p
miRNA Sequence	CAGGCACGGGAGCUCAGGUGAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 13	miR-3924 directly targets SLC8A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP//HITS-CLIP
miRNA Stemloop ID	miR-3924	miRNA Mature ID	miR-3924
miRNA Sequence	AUAUGUAUAUGUGACUGCUACU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 14	miR-3978 directly targets SLC8A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3978	miRNA Mature ID	miR-3978
miRNA Sequence	GUGGAAAGCAUGCAUCCAGGGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-410 directly targets SLC8A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP//HITS-CLIP
miRNA Stemloop ID	miR-410	miRNA Mature ID	miR-410-3p
miRNA Sequence	AAUAUAACACAGAUGGCCUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 16	miR-4282 directly targets SLC8A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4282	miRNA Mature ID	miR-4282
miRNA Sequence	UAAAAUUUGCAUCCAGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-4423 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4423	miRNA Mature ID	miR-4423-3p
miRNA Sequence	AUAGGCACCAAAAAGCAACAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 18	miR-4668 directly targets SLC8A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4668	miRNA Mature ID	miR-4668-3p
miRNA Sequence	GAAAAUCCUUUUUGUUUUUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-4683 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4683	miRNA Mature ID	miR-4683
miRNA Sequence	UGGAGAUCCAGUGCUCGCCCGAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 20	miR-4699 directly targets SLC8A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4699	miRNA Mature ID	miR-4699-3p
miRNA Sequence	AAUUUACUCUGCAAUCUUCUCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 21	miR-4766 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4766	miRNA Mature ID	miR-4766-5p
miRNA Sequence	UCUGAAAGAGCAGUUGGUGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 22	miR-4775 directly targets SLC8A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4775	miRNA Mature ID	miR-4775
miRNA Sequence	UUAAUUUUUUGUUUCGGUCACU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 23	miR-4784 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4784	miRNA Mature ID	miR-4784
miRNA Sequence	UGAGGAGAUGCUGGGACUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 24	miR-494 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-494	miRNA Mature ID	miR-494-3p
miRNA Sequence	UGAAACAUACACGGGAAACCUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 25	miR-500a directly targets SLC8A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-500a	miRNA Mature ID	miR-500a-5p
miRNA Sequence	UAAUCCUUGCUACCUGGGUGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-501 directly targets SLC8A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-501	miRNA Mature ID	miR-501-5p
miRNA Sequence	AAUCCUUUGUCCCUGGGUGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-5011 directly targets SLC8A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP//HITS-CLIP
miRNA Stemloop ID	miR-5011	miRNA Mature ID	miR-5011-5p
miRNA Sequence	UAUAUAUACAGCCAUGCACUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 28	miR-507 directly targets SLC8A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-507	miRNA Mature ID	miR-507
miRNA Sequence	UUUUGCACCUUUUGGAGUGAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 29	miR-512 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-512	miRNA Mature ID	miR-512-3p
miRNA Sequence	AAGUGCUGUCAUAGCUGAGGUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 30	miR-513a directly targets SLC8A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-513a	miRNA Mature ID	miR-513a-3p
miRNA Sequence	UAAAUUUCACCUUUCUGAGAAGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 31	miR-513c directly targets SLC8A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-513c	miRNA Mature ID	miR-513c-3p
miRNA Sequence	UAAAUUUCACCUUUCUGAGAAGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 32	miR-557 directly targets SLC8A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-557	miRNA Mature ID	miR-557
miRNA Sequence	GUUUGCACGGGUGGGCCUUGUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 33	miR-5582 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5582	miRNA Mature ID	miR-5582-5p
miRNA Sequence	UAGGCACACUUAAAGUUAUAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 34	miR-5693 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5693	miRNA Mature ID	miR-5693
miRNA Sequence	GCAGUGGCUCUGAAAUGAACUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 35	miR-590 directly targets SLC8A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP//HITS-CLIP
miRNA Stemloop ID	miR-590	miRNA Mature ID	miR-590-3p
miRNA Sequence	UAAUUUUAUGUAUAAGCUAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 36	miR-599 directly targets SLC8A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-599	miRNA Mature ID	miR-599
miRNA Sequence	GUUGUGUCAGUUUAUCAAAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 37	miR-6124 directly targets SLC8A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6124	miRNA Mature ID	miR-6124
miRNA Sequence	GGGAAAAGGAAGGGGGAGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 38	miR-6822 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6822	miRNA Mature ID	miR-6822-3p
miRNA Sequence	AGGCUCUAACUGGCUUUCCCUGCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 39	miR-6847 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6847	miRNA Mature ID	miR-6847-5p
miRNA Sequence	ACAGAGGACAGUGGAGUGUGAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 40	miR-6888 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6888	miRNA Mature ID	miR-6888-5p
miRNA Sequence	AAGGAGAUGCUCAGGCAGAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 41	miR-760 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-760	miRNA Mature ID	miR-760
miRNA Sequence	CGGCUCUGGGUCUGUGGGGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 42	miR-8057 directly targets SLC8A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-8057	miRNA Mature ID	miR-8057
miRNA Sequence	GUGGCUCUGUAGUAAGAUGGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	DNA Methylation Dynamics in Urological Tumors.
2	Genome-wide Scan for Methylation Profiles in Breast Cancer
3	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
11	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
13	Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
14	A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
15	Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
16	Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence