Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0481 Transporter Info
Gene Name	SLC9A1
Transporter Name	Sodium/hydrogen exchanger 1
Gene ID	6548
UniProt ID	P19634

Epigenetic Regulations of This DT (EGR)
Methylation
Pancretic ductal adenocarcinoma	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg08639339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.58E+00	Statistic Test	p-value: 4.79E-10; Z-score: -1.87E+00
Methylation in Case	3.81E-01 (Median)	Methylation in Control	6.03E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg07186154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.56E+00	Statistic Test	p-value: 2.58E-03; Z-score: 6.08E-01
Methylation in Case	1.63E-01 (Median)	Methylation in Control	1.05E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg23346773)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.41E+00	Statistic Test	p-value: 1.08E-04; Z-score: -1.03E+00
Methylation in Case	1.25E-01 (Median)	Methylation in Control	1.77E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS200 (cg07966717)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 1.21E-03; Z-score: -5.55E-01
Methylation in Case	7.71E-02 (Median)	Methylation in Control	8.63E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg17526887)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 4.39E-08; Z-score: -1.37E+00
Methylation in Case	5.09E-01 (Median)	Methylation in Control	6.26E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC9A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg01561807)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 4.39E-05; Z-score: -1.38E+00
Methylation in Case	7.15E-01 (Median)	Methylation in Control	8.70E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC9A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg05603680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.75E-04; Z-score: -8.42E-01
Methylation in Case	5.74E-01 (Median)	Methylation in Control	6.52E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC9A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg05230567)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 8.36E-04; Z-score: -1.04E+00
Methylation in Case	4.43E-01 (Median)	Methylation in Control	6.00E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC9A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg02262187)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.43E+00	Statistic Test	p-value: 1.86E-03; Z-score: -1.08E+00
Methylation in Case	1.81E-01 (Median)	Methylation in Control	2.59E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC9A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg14688430)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 2.82E-03; Z-score: 9.48E-01
Methylation in Case	7.56E-01 (Median)	Methylation in Control	6.99E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC9A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg07374465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 2.34E-02; Z-score: 2.91E-01
Methylation in Case	8.91E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC9A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg05393733)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 3.28E-02; Z-score: 2.65E-01
Methylation in Case	8.52E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC9A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg10374523)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 3.67E-02; Z-score: 4.01E-01
Methylation in Case	3.39E-01 (Median)	Methylation in Control	3.01E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Breast cancer	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	TSS1500 (cg15076659)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 4.63E-03; Z-score: 5.20E-01
Methylation in Case	5.85E-02 (Median)	Methylation in Control	4.85E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	1stExon (cg26515162)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 4.75E-02; Z-score: 7.30E-01
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	Body (cg07359379)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.62E+00	Statistic Test	p-value: 6.92E-31; Z-score: 3.85E+00
Methylation in Case	6.98E-01 (Median)	Methylation in Control	4.32E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	Body (cg24738346)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.98E+00	Statistic Test	p-value: 1.85E-18; Z-score: 4.09E+00
Methylation in Case	4.80E-01 (Median)	Methylation in Control	2.42E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	Body (cg00456216)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 1.72E-11; Z-score: 1.90E+00
Methylation in Case	6.49E-01 (Median)	Methylation in Control	5.70E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	Body (cg15030789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 3.31E-08; Z-score: -1.58E+00
Methylation in Case	5.73E-01 (Median)	Methylation in Control	7.15E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	Body (cg09725874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 6.03E-06; Z-score: 1.50E+00
Methylation in Case	3.47E-01 (Median)	Methylation in Control	2.72E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	Body (cg05778820)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 8.30E-04; Z-score: 1.23E+00
Methylation in Case	6.75E-01 (Median)	Methylation in Control	6.07E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	Body (cg04912273)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 1.47E-03; Z-score: 1.16E+00
Methylation in Case	7.57E-01 (Median)	Methylation in Control	6.91E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	Body (cg25130381)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 1.89E-03; Z-score: 3.18E-01
Methylation in Case	7.34E-01 (Median)	Methylation in Control	7.07E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	Body (cg13300580)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 6.54E-03; Z-score: 5.09E-01
Methylation in Case	6.87E-01 (Median)	Methylation in Control	6.63E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	Body (cg25098478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 9.05E-03; Z-score: 1.23E+00
Methylation in Case	4.60E-01 (Median)	Methylation in Control	4.11E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	Body (cg20816789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.16E-02; Z-score: -8.76E-01
Methylation in Case	6.22E-01 (Median)	Methylation in Control	6.58E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	Body (cg22488568)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.24E-02; Z-score: 1.48E+00
Methylation in Case	9.45E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	3'UTR (cg11673687)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 1.58E-14; Z-score: 2.20E+00
Methylation in Case	5.80E-01 (Median)	Methylation in Control	4.28E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC9A1 in breast cancer			[ 2 ]
Location	3'UTR (cg20942867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.46E+00	Statistic Test	p-value: 2.93E-05; Z-score: -1.17E+00
Methylation in Case	1.38E-01 (Median)	Methylation in Control	2.02E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A1 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg11743054)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 1.90E-06; Z-score: 1.46E+00
Methylation in Case	2.44E-02 (Median)	Methylation in Control	1.91E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A1 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg17856610)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 7.94E-05; Z-score: 9.32E-01
Methylation in Case	3.02E-02 (Median)	Methylation in Control	2.69E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A1 in clear cell renal cell carcinoma			[ 3 ]
Location	1stExon (cg22481448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 6.05E-09; Z-score: 1.76E+00
Methylation in Case	9.57E-01 (Median)	Methylation in Control	8.98E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A1 in clear cell renal cell carcinoma			[ 3 ]
Location	1stExon (cg18594482)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 1.05E-04; Z-score: 2.92E+00
Methylation in Case	9.65E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A1 in clear cell renal cell carcinoma			[ 3 ]
Location	1stExon (cg26515162)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 9.10E-03; Z-score: 1.15E+00
Methylation in Case	9.64E-01 (Median)	Methylation in Control	9.49E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A1 in colon adenocarcinoma			[ 4 ]
Location	TSS1500 (cg06066676)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 2.12E-06; Z-score: -4.94E+00
Methylation in Case	6.60E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A1 in colon adenocarcinoma			[ 4 ]
Location	TSS1500 (cg04974130)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.54E+00	Statistic Test	p-value: 2.80E-05; Z-score: 3.41E+00
Methylation in Case	3.62E-01 (Median)	Methylation in Control	2.34E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A1 in colon adenocarcinoma			[ 4 ]
Location	Body (cg21602614)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.52E+00	Statistic Test	p-value: 1.30E-07; Z-score: -2.28E+00
Methylation in Case	2.24E-01 (Median)	Methylation in Control	3.39E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A1 in colon adenocarcinoma			[ 4 ]
Location	Body (cg23023466)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 3.19E-05; Z-score: -1.43E+00
Methylation in Case	1.30E-01 (Median)	Methylation in Control	1.76E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A1 in colon adenocarcinoma			[ 4 ]
Location	Body (cg27005847)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.37E-03; Z-score: -1.15E+00
Methylation in Case	4.81E-01 (Median)	Methylation in Control	5.47E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A1 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg15076659)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.47E-03; Z-score: 8.21E-01
Methylation in Case	8.99E-02 (Median)	Methylation in Control	7.57E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A1 in colorectal cancer			[ 5 ]
Location	1stExon (cg18594482)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.37E-02; Z-score: -4.06E-01
Methylation in Case	9.09E-01 (Median)	Methylation in Control	9.52E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A1 in colorectal cancer			[ 5 ]
Location	Body (cg15030789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.01E-10; Z-score: -2.84E+00
Methylation in Case	7.49E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A1 in colorectal cancer			[ 5 ]
Location	Body (cg11244695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.72E-06; Z-score: -2.01E+00
Methylation in Case	9.24E-01 (Median)	Methylation in Control	9.44E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A1 in colorectal cancer			[ 5 ]
Location	Body (cg05778820)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 4.61E-05; Z-score: 1.03E+00
Methylation in Case	8.57E-01 (Median)	Methylation in Control	7.59E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC9A1 in colorectal cancer			[ 5 ]
Location	Body (cg09725874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 1.62E-04; Z-score: 1.09E+00
Methylation in Case	4.38E-01 (Median)	Methylation in Control	3.58E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC9A1 in colorectal cancer			[ 5 ]
Location	Body (cg13300580)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.13E-03; Z-score: -7.22E-01
Methylation in Case	8.62E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC9A1 in colorectal cancer			[ 5 ]
Location	Body (cg25130381)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 3.87E-03; Z-score: -1.08E+00
Methylation in Case	8.21E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC9A1 in colorectal cancer			[ 5 ]
Location	Body (cg00456216)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.08E-02; Z-score: -6.71E-01
Methylation in Case	7.29E-01 (Median)	Methylation in Control	7.57E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg20473622)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 1.34E-18; Z-score: -3.47E+00
Methylation in Case	4.90E-01 (Median)	Methylation in Control	6.74E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg22367705)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.45E+00	Statistic Test	p-value: 3.83E-02; Z-score: 2.73E-01
Methylation in Case	7.33E-02 (Median)	Methylation in Control	5.04E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	1stExon (cg18594482)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 7.44E-03; Z-score: -2.90E-01
Methylation in Case	9.47E-01 (Median)	Methylation in Control	9.49E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	1stExon (cg26515162)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 4.72E-02; Z-score: -1.99E-01
Methylation in Case	9.54E-01 (Median)	Methylation in Control	9.57E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg18677812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.82E+00	Statistic Test	p-value: 3.69E-22; Z-score: -7.04E+00
Methylation in Case	4.41E-01 (Median)	Methylation in Control	8.03E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg18886814)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 6.19E-19; Z-score: -2.12E+00
Methylation in Case	5.48E-01 (Median)	Methylation in Control	6.64E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg09725874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 8.28E-08; Z-score: 1.27E+00
Methylation in Case	4.92E-01 (Median)	Methylation in Control	4.09E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg00456216)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 9.31E-06; Z-score: -9.91E-01
Methylation in Case	6.88E-01 (Median)	Methylation in Control	7.13E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg25098478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.15E-05; Z-score: 1.27E+00
Methylation in Case	6.61E-01 (Median)	Methylation in Control	6.09E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg22488568)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.19E-04; Z-score: -5.81E-01
Methylation in Case	9.74E-01 (Median)	Methylation in Control	9.78E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg25130381)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 4.97E-04; Z-score: -1.13E+00
Methylation in Case	7.20E-01 (Median)	Methylation in Control	7.57E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg11244695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 4.63E-03; Z-score: -4.42E-01
Methylation in Case	8.53E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg24738346)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 5.49E-03; Z-score: 1.11E+00
Methylation in Case	5.51E-01 (Median)	Methylation in Control	4.68E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg17820878)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 8.28E-03; Z-score: -7.43E-01
Methylation in Case	9.45E-01 (Median)	Methylation in Control	9.57E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg13300580)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 4.43E-02; Z-score: 5.45E-01
Methylation in Case	6.49E-01 (Median)	Methylation in Control	6.31E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC9A1 in hepatocellular carcinoma			[ 6 ]
Location	3'UTR (cg11673687)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.16E-02; Z-score: -2.69E-01
Methylation in Case	7.62E-01 (Median)	Methylation in Control	7.72E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A1 in papillary thyroid cancer			[ 7 ]
Location	TSS1500 (cg11743054)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.53E-03; Z-score: -5.09E-01
Methylation in Case	6.92E-02 (Median)	Methylation in Control	7.57E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A1 in papillary thyroid cancer			[ 7 ]
Location	TSS1500 (cg26151283)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 4.16E-02; Z-score: 2.20E-01
Methylation in Case	7.55E-02 (Median)	Methylation in Control	7.39E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A1 in papillary thyroid cancer			[ 7 ]
Location	Body (cg20816789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 1.95E-13; Z-score: -2.05E+00
Methylation in Case	7.48E-01 (Median)	Methylation in Control	8.28E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A1 in papillary thyroid cancer			[ 7 ]
Location	Body (cg07359379)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.57E+00	Statistic Test	p-value: 3.75E-10; Z-score: -1.84E+00
Methylation in Case	3.21E-01 (Median)	Methylation in Control	5.02E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A1 in papillary thyroid cancer			[ 7 ]
Location	Body (cg22488568)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 4.86E-05; Z-score: 6.60E-01
Methylation in Case	9.40E-01 (Median)	Methylation in Control	9.32E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC9A1 in papillary thyroid cancer			[ 7 ]
Location	Body (cg24738346)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 7.18E-05; Z-score: 1.27E+00
Methylation in Case	7.26E-01 (Median)	Methylation in Control	6.58E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC9A1 in papillary thyroid cancer			[ 7 ]
Location	Body (cg11244695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.87E-03; Z-score: -7.31E-01
Methylation in Case	9.44E-01 (Median)	Methylation in Control	9.51E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC9A1 in papillary thyroid cancer			[ 7 ]
Location	Body (cg15030789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 4.36E-03; Z-score: -8.70E-01
Methylation in Case	7.90E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC9A1 in papillary thyroid cancer			[ 7 ]
Location	Body (cg25130381)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.12E-02; Z-score: 1.08E+00
Methylation in Case	7.44E-01 (Median)	Methylation in Control	7.10E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC9A1 in papillary thyroid cancer			[ 7 ]
Location	Body (cg25098478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 4.30E-02; Z-score: 7.98E-01
Methylation in Case	5.45E-01 (Median)	Methylation in Control	5.12E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC9A1 in papillary thyroid cancer			[ 7 ]
Location	3'UTR (cg11673687)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.48E+00	Statistic Test	p-value: 2.61E-18; Z-score: -4.56E+00
Methylation in Case	4.84E-01 (Median)	Methylation in Control	7.18E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC9A1 in papillary thyroid cancer			[ 7 ]
Location	3'UTR (cg20942867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 6.42E-14; Z-score: -1.75E+00
Methylation in Case	1.42E-01 (Median)	Methylation in Control	2.00E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A1 in prostate cancer			[ 8 ]
Location	TSS1500 (cg05996789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 9.37E-03; Z-score: -7.57E+00
Methylation in Case	7.73E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A1 in prostate cancer			[ 8 ]
Location	Body (cg25970471)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 5.20E-03; Z-score: 3.20E+00
Methylation in Case	8.57E-01 (Median)	Methylation in Control	7.71E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A1 in prostate cancer			[ 8 ]
Location	Body (cg17434453)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.87E-02; Z-score: 2.16E+00
Methylation in Case	9.28E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A1 in prostate cancer			[ 8 ]
Location	Body (cg12228245)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.12E+00	Statistic Test	p-value: 4.73E-02; Z-score: 1.97E+01
Methylation in Case	1.97E-01 (Median)	Methylation in Control	4.77E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A1 in prostate cancer			[ 8 ]
Location	3'UTR (cg16785291)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 1.94E-03; Z-score: 3.38E+00
Methylation in Case	8.17E-01 (Median)	Methylation in Control	6.28E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A1 in lung adenocarcinoma			[ 9 ]
Location	TSS200 (cg22367705)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 1.71E-03; Z-score: 1.76E+00
Methylation in Case	2.02E-01 (Median)	Methylation in Control	1.55E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A1 in lung adenocarcinoma			[ 9 ]
Location	Body (cg24738346)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.39E+00	Statistic Test	p-value: 2.08E-04; Z-score: 3.75E+00
Methylation in Case	6.57E-01 (Median)	Methylation in Control	4.74E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A1 in lung adenocarcinoma			[ 9 ]
Location	Body (cg25130381)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 3.07E-03; Z-score: 1.75E+00
Methylation in Case	7.26E-01 (Median)	Methylation in Control	6.28E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A1 in lung adenocarcinoma			[ 9 ]
Location	Body (cg13300580)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 3.50E-03; Z-score: 1.81E+00
Methylation in Case	7.06E-01 (Median)	Methylation in Control	6.25E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A1 in lung adenocarcinoma			[ 9 ]
Location	3'UTR (cg20942867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.86E+00	Statistic Test	p-value: 4.12E-04; Z-score: -2.02E+00
Methylation in Case	1.58E-01 (Median)	Methylation in Control	2.93E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Bladder cancer	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	1stExon (cg22481448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -4.14E+00	Statistic Test	p-value: 2.18E-16; Z-score: -2.37E+01
Methylation in Case	2.17E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	1stExon (cg18594482)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.87E+00	Statistic Test	p-value: 5.30E-15; Z-score: -1.47E+01
Methylation in Case	4.63E-01 (Median)	Methylation in Control	8.64E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	1stExon (cg26515162)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.58E+00	Statistic Test	p-value: 2.95E-14; Z-score: -2.34E+01
Methylation in Case	3.51E-01 (Median)	Methylation in Control	9.06E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	Body (cg00456216)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 2.11E-07; Z-score: 6.32E+00
Methylation in Case	6.34E-01 (Median)	Methylation in Control	4.98E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	Body (cg25130381)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 4.29E-07; Z-score: 6.82E+00
Methylation in Case	8.13E-01 (Median)	Methylation in Control	7.08E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	Body (cg07359379)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.53E+00	Statistic Test	p-value: 3.32E-06; Z-score: 5.31E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	5.03E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	Body (cg22488568)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 1.38E-05; Z-score: 5.31E+00
Methylation in Case	9.70E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	Body (cg26313337)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.73E+00	Statistic Test	p-value: 4.21E-05; Z-score: -5.06E+00
Methylation in Case	3.33E-01 (Median)	Methylation in Control	5.77E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	Body (cg11244695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 7.57E-05; Z-score: -3.88E+00
Methylation in Case	8.45E-01 (Median)	Methylation in Control	8.91E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	Body (cg25098478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 1.16E-04; Z-score: -5.24E+00
Methylation in Case	3.36E-01 (Median)	Methylation in Control	4.54E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	Body (cg13300580)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 6.72E-04; Z-score: 3.39E+00
Methylation in Case	7.38E-01 (Median)	Methylation in Control	6.78E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	Body (cg04912273)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.14E-03; Z-score: 2.49E+00
Methylation in Case	8.13E-01 (Median)	Methylation in Control	7.44E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	Body (cg09725874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.15E+00	Statistic Test	p-value: 2.08E-03; Z-score: -2.71E+00
Methylation in Case	1.48E-01 (Median)	Methylation in Control	3.19E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	Body (cg24738346)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.00E+00	Statistic Test	p-value: 5.63E-03; Z-score: -2.42E+00
Methylation in Case	2.02E-01 (Median)	Methylation in Control	4.03E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	Body (cg05778820)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 1.56E-02; Z-score: 2.09E+00
Methylation in Case	6.20E-01 (Median)	Methylation in Control	4.43E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC9A1 in bladder cancer			[ 10 ]
Location	3'UTR (cg11673687)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.56E+00	Statistic Test	p-value: 3.73E-05; Z-score: 4.28E+00
Methylation in Case	6.84E-01 (Median)	Methylation in Control	4.39E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Panic disorder	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A1 in panic disorder			[ 11 ]
Location	1stExon (cg22481448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 4.68E-02; Z-score: 5.50E-01
Methylation in Case	4.71E+00 (Median)	Methylation in Control	4.55E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A1 in panic disorder			[ 11 ]
Location	Body (cg20816789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 3.62E-03; Z-score: 7.74E-01
Methylation in Case	1.58E+00 (Median)	Methylation in Control	1.37E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A1 in panic disorder			[ 11 ]
Location	Body (cg04912273)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 3.63E-03; Z-score: -4.54E-01
Methylation in Case	2.91E+00 (Median)	Methylation in Control	3.06E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A1 in panic disorder			[ 11 ]
Location	Body (cg05778820)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.08E-02; Z-score: -2.01E-01
Methylation in Case	3.23E+00 (Median)	Methylation in Control	3.29E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A1 in panic disorder			[ 11 ]
Location	Body (cg11244695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 4.12E-02; Z-score: 3.56E-01
Methylation in Case	3.13E+00 (Median)	Methylation in Control	2.95E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC9A1 in panic disorder			[ 11 ]
Location	3'UTR (cg20942867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.56E-01	Statistic Test	p-value: 2.71E-02; Z-score: -3.58E-01
Methylation in Case	-4.51E+00 (Median)	Methylation in Control	-4.31E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Craniopharyngioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC9A1 in craniopharyngioma than that in healthy individual
Studied Phenotype	Craniopharyngioma [ICD-11:2F9A]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.68E-14; Fold-change: -0.206638728; Z-score: -3.3739486
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Hemangioblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC9A1 in hemangioblastoma than that in healthy individual
Studied Phenotype	Hemangioblastoma [ICD-11:2F7C]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.50E-12; Fold-change: -0.214569817; Z-score: -2.968539067
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC9A1 in melanocytoma than that in healthy individual
Studied Phenotype	Melanocytoma [ICD-11:2F36.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 5.78E-08; Fold-change: -0.226874282; Z-score: -7.283139691
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC9A1 in melanoma than that in healthy individual
Studied Phenotype	Melanoma [ICD-11:2C30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 4.56E-06; Fold-change: -0.264019576; Z-score: -3.423107077
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Peripheral neuroectodermal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC9A1 in peripheral neuroectodermal tumour than that in healthy individual
Studied Phenotype	Peripheral neuroectodermal tumour [ICD-11:2B52]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.39E-08; Fold-change: -0.279275043; Z-score: -4.348504017
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Posterior fossa ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC9A1 in posterior fossa ependymoma than that in healthy individual
Studied Phenotype	Posterior fossa ependymoma [ICD-11:2D50.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 4.12E-64; Fold-change: -0.206737652; Z-score: -2.399968945
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC9A1 in brain neuroblastoma than that in healthy individual
Studied Phenotype	Brain neuroblastoma [ICD-11:2A00.11]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.17E-15; Fold-change: -0.326495897; Z-score: -5.033273764
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Chordoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC9A1 in chordoma than that in healthy individual
Studied Phenotype	Chordoma [ICD-11:5A61.0]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.53E-07; Fold-change: -0.474358367; Z-score: -5.50334359
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	29 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-106b directly targets SLC9A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-106b	miRNA Mature ID	miR-106b-5p
miRNA Sequence	UAAAGUGCUGACAGUGCAGAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 2	miR-122 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-122	miRNA Mature ID	miR-122-5p
miRNA Sequence	UGGAGUGUGACAAUGGUGUUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-147a directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-147a	miRNA Mature ID	miR-147a
miRNA Sequence	GUGUGUGGAAAUGCUUCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-15a directly targets SLC9A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-15a	miRNA Mature ID	miR-15a-5p
miRNA Sequence	UAGCAGCACAUAAUGGUUUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-15b directly targets SLC9A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-15b	miRNA Mature ID	miR-15b-5p
miRNA Sequence	UAGCAGCACAUCAUGGUUUACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-16 directly targets SLC9A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-16	miRNA Mature ID	miR-16-5p
miRNA Sequence	UAGCAGCACGUAAAUAUUGGCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-195 directly targets SLC9A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-195	miRNA Mature ID	miR-195-5p
miRNA Sequence	UAGCAGCACAGAAAUAUUGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-19a directly targets SLC9A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-19a	miRNA Mature ID	miR-19a-3p
miRNA Sequence	UGUGCAAAUCUAUGCAAAACUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-19b directly targets SLC9A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-19b	miRNA Mature ID	miR-19b-3p
miRNA Sequence	UGUGCAAAUCCAUGCAAAACUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-32 directly targets SLC9A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-32	miRNA Mature ID	miR-32-5p
miRNA Sequence	UAUUGCACAUUACUAAGUUGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-331 directly targets SLC9A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-331	miRNA Mature ID	miR-331-3p
miRNA Sequence	GCCCCUGGGCCUAUCCUAGAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 12	miR-3911 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3911	miRNA Mature ID	miR-3911
miRNA Sequence	UGUGUGGAUCCUGGAGGAGGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-4265 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4265	miRNA Mature ID	miR-4265
miRNA Sequence	CUGUGGGCUCAGCUCUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-4271 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4271	miRNA Mature ID	miR-4271
miRNA Sequence	GGGGGAAGAAAAGGUGGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-4296 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4296	miRNA Mature ID	miR-4296
miRNA Sequence	AUGUGGGCUCAGGCUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-4322 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4322	miRNA Mature ID	miR-4322
miRNA Sequence	CUGUGGGCUCAGCGCGUGGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-4433b directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4433b	miRNA Mature ID	miR-4433b-3p
miRNA Sequence	CAGGAGUGGGGGGUGGGACGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-4533 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4533	miRNA Mature ID	miR-4533
miRNA Sequence	UGGAAGGAGGUUGCCGGACGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-4725 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4725	miRNA Mature ID	miR-4725-3p
miRNA Sequence	UGGGGAAGGCGUCAGUGUCGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-4747 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4747	miRNA Mature ID	miR-4747-5p
miRNA Sequence	AGGGAAGGAGGCUUGGUCUUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-5196 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5196	miRNA Mature ID	miR-5196-5p
miRNA Sequence	AGGGAAGGGGACGAGGGUUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-574 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-574	miRNA Mature ID	miR-574-5p
miRNA Sequence	UGAGUGUGUGUGUGUGAGUGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-644a directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-644a	miRNA Mature ID	miR-644a
miRNA Sequence	AGUGUGGCUUUCUUAGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-6780b directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6780b	miRNA Mature ID	miR-6780b-5p
miRNA Sequence	UGGGGAAGGCUUGGCAGGGAAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-6783 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6783	miRNA Mature ID	miR-6783-5p
miRNA Sequence	UAGGGGAAAAGUCCUGAUCCGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-6867 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6867	miRNA Mature ID	miR-6867-5p
miRNA Sequence	UGUGUGUGUAGAGGAAGAAGGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-7845 directly targets SLC9A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7845	miRNA Mature ID	miR-7845-5p
miRNA Sequence	AAGGGACAGGGAGGGUCGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-92a directly targets SLC9A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-92a	miRNA Mature ID	miR-92a-3p
miRNA Sequence	UAUUGCACUUGUCCCGGCCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 29	miR-92b directly targets SLC9A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-92b	miRNA Mature ID	miR-92b-3p
miRNA Sequence	UAUUGCACUCGUCCCGGCCUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2	Genome-wide Scan for Methylation Profiles in Breast Cancer
3	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10	DNA Methylation Dynamics in Urological Tumors.
11	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
13	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
14	EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence