Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0482 Transporter Info
Gene Name	SLC9A2
Transporter Name	Sodium/hydrogen exchanger 2
Gene ID	6549
UniProt ID	Q9UBY0

Epigenetic Regulations of This DT (EGR)
Methylation
Bladder cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A2 in bladder cancer			[ 1 ]
Location	TSS1500 (cg04297105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.87E+00	Statistic Test	p-value: 7.79E-04; Z-score: -3.52E+00
Methylation in Case	1.25E-01 (Median)	Methylation in Control	2.34E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A2 in bladder cancer			[ 1 ]
Location	1stExon (cg11915641)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.59E+00	Statistic Test	p-value: 1.03E-02; Z-score: -5.35E+00
Methylation in Case	6.03E-02 (Median)	Methylation in Control	9.56E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A2 in bladder cancer			[ 1 ]
Location	Body (cg17343107)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 2.81E-06; Z-score: -4.64E+00
Methylation in Case	4.70E-01 (Median)	Methylation in Control	6.30E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A2 in bladder cancer			[ 1 ]
Location	Body (cg20050113)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.38E+00	Statistic Test	p-value: 3.57E-06; Z-score: -5.83E+00
Methylation in Case	1.61E-01 (Median)	Methylation in Control	3.84E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A2 in bladder cancer			[ 1 ]
Location	Body (cg15992711)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 3.06E-05; Z-score: -3.88E+00
Methylation in Case	3.32E-01 (Median)	Methylation in Control	4.23E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC9A2 in bladder cancer			[ 1 ]
Location	Body (cg26572770)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 5.76E-05; Z-score: -5.57E+00
Methylation in Case	6.57E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC9A2 in bladder cancer			[ 1 ]
Location	Body (cg15704872)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.95E-03; Z-score: 2.69E+00
Methylation in Case	4.43E-01 (Median)	Methylation in Control	3.71E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC9A2 in bladder cancer			[ 1 ]
Location	Body (cg26829418)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 3.09E-03; Z-score: -3.19E+00
Methylation in Case	6.81E-01 (Median)	Methylation in Control	7.29E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC9A2 in bladder cancer			[ 1 ]
Location	3'UTR (cg21880222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.67E+00	Statistic Test	p-value: 1.50E-03; Z-score: -3.70E+00
Methylation in Case	2.95E-01 (Median)	Methylation in Control	4.95E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A2 in breast cancer			[ 2 ]
Location	TSS1500 (cg04532229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.31E+00	Statistic Test	p-value: 2.52E-03; Z-score: 7.07E-01
Methylation in Case	2.98E-02 (Median)	Methylation in Control	2.28E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A2 in breast cancer			[ 2 ]
Location	TSS1500 (cg13411038)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 1.28E-02; Z-score: 1.88E-01
Methylation in Case	1.88E-02 (Median)	Methylation in Control	1.57E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A2 in breast cancer			[ 2 ]
Location	TSS1500 (cg05021854)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 4.95E-02; Z-score: 6.26E-02
Methylation in Case	1.10E-01 (Median)	Methylation in Control	1.09E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A2 in breast cancer			[ 2 ]
Location	TSS200 (cg24751648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.24E-02; Z-score: 1.90E-01
Methylation in Case	1.06E-01 (Median)	Methylation in Control	1.00E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A2 in breast cancer			[ 2 ]
Location	1stExon (cg11915641)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 2.61E-02; Z-score: 6.20E-01
Methylation in Case	1.21E-01 (Median)	Methylation in Control	1.02E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC9A2 in breast cancer			[ 2 ]
Location	Body (cg26829418)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 1.30E-07; Z-score: -1.63E+00
Methylation in Case	5.43E-01 (Median)	Methylation in Control	6.82E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC9A2 in breast cancer			[ 2 ]
Location	Body (cg15992711)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 4.46E-03; Z-score: -9.67E-01
Methylation in Case	3.50E-01 (Median)	Methylation in Control	4.37E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC9A2 in breast cancer			[ 2 ]
Location	Body (cg17343107)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 4.06E-02; Z-score: -3.73E-01
Methylation in Case	5.46E-01 (Median)	Methylation in Control	5.70E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC9A2 in breast cancer			[ 2 ]
Location	3'UTR (cg21880222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.56E-13; Z-score: 2.36E+00
Methylation in Case	7.49E-01 (Median)	Methylation in Control	6.31E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A2 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg13411038)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 2.59E-03; Z-score: 1.02E+00
Methylation in Case	1.58E-02 (Median)	Methylation in Control	1.32E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A2 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg04532229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.35E-02; Z-score: 4.12E-01
Methylation in Case	2.08E-02 (Median)	Methylation in Control	1.98E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A2 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg24751648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 2.45E-02; Z-score: 5.62E-01
Methylation in Case	6.82E-02 (Median)	Methylation in Control	5.64E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A2 in clear cell renal cell carcinoma			[ 3 ]
Location	1stExon (cg11915641)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.51E+00	Statistic Test	p-value: 5.75E-05; Z-score: 1.27E+00
Methylation in Case	7.89E-02 (Median)	Methylation in Control	5.24E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A2 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg26829418)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.36E-03; Z-score: -1.49E+00
Methylation in Case	8.84E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A2 in colon adenocarcinoma			[ 4 ]
Location	TSS1500 (cg12122597)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.67E+00	Statistic Test	p-value: 2.35E-05; Z-score: 2.32E+00
Methylation in Case	5.85E-01 (Median)	Methylation in Control	3.51E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A2 in colon adenocarcinoma			[ 4 ]
Location	Body (cg19081390)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 4.23E-04; Z-score: -1.54E+00
Methylation in Case	7.00E-01 (Median)	Methylation in Control	7.56E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A2 in colon adenocarcinoma			[ 4 ]
Location	Body (cg01840128)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 5.47E-04; Z-score: 1.24E+00
Methylation in Case	8.87E-01 (Median)	Methylation in Control	8.45E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A2 in colon adenocarcinoma			[ 4 ]
Location	Body (cg05369268)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.08E-03; Z-score: -3.50E+00
Methylation in Case	8.88E-01 (Median)	Methylation in Control	9.49E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A2 in colon adenocarcinoma			[ 4 ]
Location	Body (cg25582398)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.51E-03; Z-score: -1.29E+00
Methylation in Case	8.46E-01 (Median)	Methylation in Control	8.68E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A2 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg04297105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 2.19E-03; Z-score: 8.41E-01
Methylation in Case	3.99E-01 (Median)	Methylation in Control	3.06E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A2 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg05021854)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 6.85E-03; Z-score: 6.99E-01
Methylation in Case	1.73E-01 (Median)	Methylation in Control	1.56E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A2 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg04532229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 2.21E-02; Z-score: -1.21E+00
Methylation in Case	3.26E-02 (Median)	Methylation in Control	4.06E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A2 in colorectal cancer			[ 5 ]
Location	Body (cg15704872)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.03E+00	Statistic Test	p-value: 7.23E-11; Z-score: 2.93E+00
Methylation in Case	6.47E-01 (Median)	Methylation in Control	3.18E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A2 in colorectal cancer			[ 5 ]
Location	Body (cg17343107)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.41E+00	Statistic Test	p-value: 1.52E-05; Z-score: 1.59E+00
Methylation in Case	7.01E-01 (Median)	Methylation in Control	4.96E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC9A2 in colorectal cancer			[ 5 ]
Location	Body (cg01272393)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 5.89E-05; Z-score: 1.59E+00
Methylation in Case	8.21E-01 (Median)	Methylation in Control	6.09E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC9A2 in colorectal cancer			[ 5 ]
Location	Body (cg26572770)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 6.56E-05; Z-score: 1.41E+00
Methylation in Case	8.21E-01 (Median)	Methylation in Control	6.12E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC9A2 in colorectal cancer			[ 5 ]
Location	Body (cg26829418)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 1.75E-02; Z-score: 7.19E-01
Methylation in Case	6.63E-01 (Median)	Methylation in Control	5.69E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC9A2 in colorectal cancer			[ 5 ]
Location	Body (cg15992711)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 4.90E-02; Z-score: 4.41E-01
Methylation in Case	4.57E-01 (Median)	Methylation in Control	4.19E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg00474031)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.45E+00	Statistic Test	p-value: 6.17E-13; Z-score: -4.80E+00
Methylation in Case	4.28E-01 (Median)	Methylation in Control	6.23E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg04532229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.34E-03; Z-score: -1.00E-01
Methylation in Case	4.68E-02 (Median)	Methylation in Control	4.87E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg05021854)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.07E-02; Z-score: 2.38E-01
Methylation in Case	1.24E-01 (Median)	Methylation in Control	1.20E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg04297105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 3.40E-02; Z-score: 4.13E-01
Methylation in Case	3.89E-01 (Median)	Methylation in Control	3.60E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg27030380)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 1.95E-16; Z-score: -9.80E+00
Methylation in Case	6.06E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg24751648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.11E-02; Z-score: -2.06E-01
Methylation in Case	9.88E-02 (Median)	Methylation in Control	1.05E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg01293740)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.56E+00	Statistic Test	p-value: 7.27E-15; Z-score: -2.08E+00
Methylation in Case	1.80E-01 (Median)	Methylation in Control	2.81E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg04609875)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.53E+00	Statistic Test	p-value: 9.40E-13; Z-score: -2.97E+00
Methylation in Case	3.94E-01 (Median)	Methylation in Control	6.02E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg25582398)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 1.11E-12; Z-score: -1.33E+01
Methylation in Case	6.28E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg05927579)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 2.64E-12; Z-score: -1.77E+00
Methylation in Case	5.15E-01 (Median)	Methylation in Control	7.11E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg15992711)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 8.08E-07; Z-score: -1.36E+00
Methylation in Case	3.04E-01 (Median)	Methylation in Control	3.92E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg13946163)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.85E+00	Statistic Test	p-value: 6.91E-06; Z-score: -1.52E+00
Methylation in Case	3.34E-01 (Median)	Methylation in Control	6.16E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg20050113)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 1.95E-03; Z-score: -1.03E+00
Methylation in Case	3.32E-01 (Median)	Methylation in Control	3.82E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC9A2 in hepatocellular carcinoma			[ 6 ]
Location	3'UTR (cg18878437)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.06E+00	Statistic Test	p-value: 7.95E-13; Z-score: 3.63E+00
Methylation in Case	4.17E-01 (Median)	Methylation in Control	2.02E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A2 in lung adenocarcinoma			[ 7 ]
Location	TSS1500 (cg04297105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 2.03E-02; Z-score: 1.42E+00
Methylation in Case	4.48E-01 (Median)	Methylation in Control	3.66E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A2 in lung adenocarcinoma			[ 7 ]
Location	TSS200 (cg01050423)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.01E+00	Statistic Test	p-value: 6.87E-03; Z-score: 6.20E+00
Methylation in Case	1.34E-01 (Median)	Methylation in Control	6.65E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A2 in lung adenocarcinoma			[ 7 ]
Location	1stExon (cg11915641)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 2.45E-02; Z-score: 2.21E+00
Methylation in Case	1.95E-01 (Median)	Methylation in Control	1.55E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A2 in lung adenocarcinoma			[ 7 ]
Location	Body (cg01272393)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.11E-02; Z-score: -1.54E+00
Methylation in Case	8.07E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A2 in lung adenocarcinoma			[ 7 ]
Location	Body (cg13946163)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 2.09E-02; Z-score: -1.07E+00
Methylation in Case	7.12E-01 (Median)	Methylation in Control	7.58E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC9A2 in lung adenocarcinoma			[ 7 ]
Location	Body (cg20050113)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 2.13E-02; Z-score: 1.99E+00
Methylation in Case	4.42E-01 (Median)	Methylation in Control	3.90E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC9A2 in lung adenocarcinoma			[ 7 ]
Location	Body (cg26829418)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 2.15E-02; Z-score: -1.36E+00
Methylation in Case	7.60E-01 (Median)	Methylation in Control	8.08E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS1500 (cg04104132)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.88E-02; Z-score: -7.35E-01
Methylation in Case	3.53E-01 (Median)	Methylation in Control	3.88E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg11131532)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.35E+00	Statistic Test	p-value: 1.09E-23; Z-score: 4.51E+00
Methylation in Case	2.01E-01 (Median)	Methylation in Control	5.99E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg04402744)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 8.02E-04; Z-score: -4.79E-01
Methylation in Case	4.27E-02 (Median)	Methylation in Control	5.03E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg13442116)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 2.95E-03; Z-score: 9.05E-01
Methylation in Case	8.91E-01 (Median)	Methylation in Control	8.70E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC9A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg04969220)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 9.90E-03; Z-score: 8.02E-01
Methylation in Case	6.36E-01 (Median)	Methylation in Control	5.32E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC9A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg23487721)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.38E-02; Z-score: -5.16E-01
Methylation in Case	5.80E-01 (Median)	Methylation in Control	6.05E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC9A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg22387939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 2.47E-02; Z-score: -4.94E-01
Methylation in Case	7.67E-02 (Median)	Methylation in Control	8.39E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC9A2 in pancretic ductal adenocarcinoma			[ 8 ]
Location	3'UTR (cg02861293)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 2.91E-04; Z-score: -2.57E-01
Methylation in Case	8.55E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A2 in papillary thyroid cancer			[ 9 ]
Location	TSS200 (cg00292986)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 4.44E-02; Z-score: 3.05E-01
Methylation in Case	9.56E-02 (Median)	Methylation in Control	9.09E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A2 in papillary thyroid cancer			[ 9 ]
Location	Body (cg26572770)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.52E-03; Z-score: -5.91E-01
Methylation in Case	9.01E-01 (Median)	Methylation in Control	9.12E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A2 in papillary thyroid cancer			[ 9 ]
Location	Body (cg01272393)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.46E-02; Z-score: -1.74E-01
Methylation in Case	9.12E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A2 in papillary thyroid cancer			[ 9 ]
Location	3'UTR (cg21880222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 8.91E-04; Z-score: 1.20E+00
Methylation in Case	8.72E-01 (Median)	Methylation in Control	8.28E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Celiac disease	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A2 in celiac disease			[ 10 ]
Location	Body (cg15992711)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 3.79E-02; Z-score: 9.97E-01
Methylation in Case	3.53E-01 (Median)	Methylation in Control	2.66E-01 (Median)
Studied Phenotype	Celiac disease [ ICD-11: DA95]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A2 in panic disorder			[ 11 ]
Location	Body (cg15704872)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 2.90E-04; Z-score: 2.26E-01
Methylation in Case	8.04E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A2 in prostate cancer			[ 12 ]
Location	Body (cg08331840)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 1.14E-02; Z-score: 2.52E+00
Methylation in Case	9.42E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC9A2 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.97E-09; Fold-change: 0.299951097; Z-score: 6.056667373
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Gastric cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC9A2 in gastric cancer than that in adjacent tissue
Studied Phenotype	Gastric cancer [ICD-11:2B72]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 1.81E-38; Fold-change: 0.210265225; Z-score: 38.9476229
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-16 directly targets SLC9A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-16	miRNA Mature ID	miR-16-5p
miRNA Sequence	UAGCAGCACGUAAAUAUUGGCG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	DNA Methylation Dynamics in Urological Tumors.
2	Genome-wide Scan for Methylation Profiles in Breast Cancer
3	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10	The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
11	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence