Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0483 Transporter Info | ||||
| Gene Name | SLC9A3 | ||||
| Transporter Name | Sodium/hydrogen exchanger 3 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Colon cancer |
46 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg08360771) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 2.19E-05; Z-score: -4.05E+00 | ||
|
Methylation in Case |
5.34E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg04882188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 9.77E-05; Z-score: -9.03E-01 | ||
|
Methylation in Case |
1.24E-01 (Median) | Methylation in Control | 1.52E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg12164612) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.52E+00 | Statistic Test | p-value: 1.19E-04; Z-score: 1.56E+00 | ||
|
Methylation in Case |
5.41E-01 (Median) | Methylation in Control | 3.56E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg20064848) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 3.16E-04; Z-score: -1.96E+00 | ||
|
Methylation in Case |
5.87E-01 (Median) | Methylation in Control | 6.55E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg14019757) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 6.45E-04; Z-score: -6.86E-01 | ||
|
Methylation in Case |
1.42E-01 (Median) | Methylation in Control | 1.62E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg06652199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.04E+00 | Statistic Test | p-value: 2.07E-07; Z-score: 5.56E+00 | ||
|
Methylation in Case |
4.28E-01 (Median) | Methylation in Control | 1.41E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg03616221) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.69E+00 | Statistic Test | p-value: 1.73E-06; Z-score: 5.30E+00 | ||
|
Methylation in Case |
5.57E-01 (Median) | Methylation in Control | 3.29E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg27162435) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 3.48E-05; Z-score: 1.15E+00 | ||
|
Methylation in Case |
7.76E-01 (Median) | Methylation in Control | 6.99E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg05330297) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.52E+00 | Statistic Test | p-value: 3.32E-04; Z-score: 5.27E+00 | ||
|
Methylation in Case |
1.90E-01 (Median) | Methylation in Control | 5.39E-02 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg15773379) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 4.18E-03; Z-score: 1.40E+00 | ||
|
Methylation in Case |
4.48E-02 (Median) | Methylation in Control | 3.34E-02 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg15026150) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.60E+00 | Statistic Test | p-value: 2.44E-06; Z-score: 6.60E+00 | ||
|
Methylation in Case |
4.13E-01 (Median) | Methylation in Control | 1.59E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg13377102) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 3.23E-05; Z-score: 1.09E+00 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg10717290) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.71E+00 | Statistic Test | p-value: 9.98E-05; Z-score: 5.05E+00 | ||
|
Methylation in Case |
4.13E-01 (Median) | Methylation in Control | 1.53E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg10387551) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 6.51E-04; Z-score: 8.38E-01 | ||
|
Methylation in Case |
4.36E-01 (Median) | Methylation in Control | 3.49E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg01663603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 4.12E-03; Z-score: 1.15E+00 | ||
|
Methylation in Case |
2.08E-01 (Median) | Methylation in Control | 1.49E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg00289429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 4.68E-03; Z-score: 1.38E+00 | ||
|
Methylation in Case |
2.05E-01 (Median) | Methylation in Control | 1.65E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg26664737) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 3.78E-08; Z-score: -3.10E+00 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 8.25E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg19521693) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.62E+00 | Statistic Test | p-value: 4.95E-08; Z-score: -3.77E+00 | ||
|
Methylation in Case |
2.77E-01 (Median) | Methylation in Control | 4.47E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg24149278) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 8.74E-08; Z-score: -4.59E+00 | ||
|
Methylation in Case |
4.59E-01 (Median) | Methylation in Control | 6.19E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg15704872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.97E+00 | Statistic Test | p-value: 5.34E-07; Z-score: 4.94E+00 | ||
|
Methylation in Case |
4.56E-01 (Median) | Methylation in Control | 2.31E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg05418487) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 5.42E-07; Z-score: -1.66E+00 | ||
|
Methylation in Case |
1.99E-01 (Median) | Methylation in Control | 2.70E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg15572436) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 6.48E-07; Z-score: -2.92E+00 | ||
|
Methylation in Case |
3.58E-01 (Median) | Methylation in Control | 5.05E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg26327804) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 8.26E-07; Z-score: 4.32E+00 | ||
|
Methylation in Case |
5.61E-01 (Median) | Methylation in Control | 4.24E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 8.49E-07; Z-score: -3.80E+00 | ||
|
Methylation in Case |
5.48E-01 (Median) | Methylation in Control | 7.05E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg22032364) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.42E+00 | Statistic Test | p-value: 1.65E-06; Z-score: -2.29E+00 | ||
|
Methylation in Case |
3.98E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg14404146) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.72E-06; Z-score: -2.70E+00 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 8.28E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg08374499) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 4.25E-06; Z-score: -2.16E+00 | ||
|
Methylation in Case |
4.14E-01 (Median) | Methylation in Control | 5.22E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg02609144) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 9.03E-06; Z-score: -1.43E+00 | ||
|
Methylation in Case |
7.72E-02 (Median) | Methylation in Control | 1.05E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg19631651) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 9.51E-06; Z-score: -2.98E+00 | ||
|
Methylation in Case |
5.57E-01 (Median) | Methylation in Control | 6.98E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg13110283) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 3.20E-05; Z-score: -1.44E+00 | ||
|
Methylation in Case |
3.39E-01 (Median) | Methylation in Control | 4.44E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg25618198) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 1.21E-04; Z-score: -3.52E+00 | ||
|
Methylation in Case |
5.61E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg25910803) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 1.75E-04; Z-score: 3.34E+00 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 5.91E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg18892212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.95E-04; Z-score: 1.03E+00 | ||
|
Methylation in Case |
6.69E-01 (Median) | Methylation in Control | 5.94E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg04987335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 2.75E-04; Z-score: -2.60E+00 | ||
|
Methylation in Case |
6.17E-01 (Median) | Methylation in Control | 7.08E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg07071839) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 3.40E-04; Z-score: -2.55E+00 | ||
|
Methylation in Case |
6.69E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg24114651) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 3.64E-04; Z-score: -3.46E+00 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg00820961) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 5.99E-04; Z-score: -1.42E+00 | ||
|
Methylation in Case |
4.96E-01 (Median) | Methylation in Control | 5.97E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg14561295) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 6.10E-04; Z-score: -2.54E+00 | ||
|
Methylation in Case |
6.91E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg06622573) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 6.11E-04; Z-score: -2.85E+00 | ||
|
Methylation in Case |
7.15E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg09407223) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 9.58E-04; Z-score: -1.15E+00 | ||
|
Methylation in Case |
5.32E-01 (Median) | Methylation in Control | 5.76E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg22172143) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 1.74E-03; Z-score: -7.43E-01 | ||
|
Methylation in Case |
2.59E-01 (Median) | Methylation in Control | 3.48E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg09119043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 2.09E-03; Z-score: -1.02E+00 | ||
|
Methylation in Case |
5.62E-01 (Median) | Methylation in Control | 6.53E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg11480762) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 2.51E-03; Z-score: -9.53E-01 | ||
|
Methylation in Case |
4.32E-01 (Median) | Methylation in Control | 4.95E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg07187808) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 3.90E-03; Z-score: 1.02E+00 | ||
|
Methylation in Case |
7.10E-01 (Median) | Methylation in Control | 6.41E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 45 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
3'UTR (cg21318380) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.65E+00 | Statistic Test | p-value: 1.01E-09; Z-score: -2.29E+00 | ||
|
Methylation in Case |
2.32E-01 (Median) | Methylation in Control | 3.84E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 46 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
3'UTR (cg11324504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 3.23E-04; Z-score: -1.32E+00 | ||
|
Methylation in Case |
6.31E-01 (Median) | Methylation in Control | 7.08E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
78 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg08180566) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 6.83E-10; Z-score: -4.17E+00 | ||
|
Methylation in Case |
5.70E-01 (Median) | Methylation in Control | 6.89E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg08830672) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 1.64E-10; Z-score: 1.57E+00 | ||
|
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg07052880) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 2.17E-10; Z-score: -7.63E+00 | ||
|
Methylation in Case |
7.00E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg23036025) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 8.68E-10; Z-score: -2.00E+00 | ||
|
Methylation in Case |
6.61E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg04934807) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.90E+00 | Statistic Test | p-value: 8.84E-10; Z-score: 4.80E+00 | ||
|
Methylation in Case |
2.15E-01 (Median) | Methylation in Control | 1.13E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg01398050) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.60E+00 | Statistic Test | p-value: 9.03E-10; Z-score: 7.92E+00 | ||
|
Methylation in Case |
1.40E-01 (Median) | Methylation in Control | 3.88E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg10528482) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.52E+00 | Statistic Test | p-value: 8.36E-08; Z-score: -3.13E+00 | ||
|
Methylation in Case |
4.27E-01 (Median) | Methylation in Control | 6.52E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg17691545) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 2.50E-16; Z-score: -8.48E+00 | ||
|
Methylation in Case |
5.25E-01 (Median) | Methylation in Control | 7.61E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg12628145) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.38E+00 | Statistic Test | p-value: 1.10E-03; Z-score: 7.34E-01 | ||
|
Methylation in Case |
4.90E-02 (Median) | Methylation in Control | 3.55E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg25861340) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 2.46E-03; Z-score: 2.23E-01 | ||
|
Methylation in Case |
5.65E-02 (Median) | Methylation in Control | 5.09E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
1stExon (cg01416043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 2.46E-12; Z-score: -7.61E+00 | ||
|
Methylation in Case |
7.04E-01 (Median) | Methylation in Control | 9.29E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg12204395) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.06E+00 | Statistic Test | p-value: 2.66E-22; Z-score: -8.28E+00 | ||
|
Methylation in Case |
3.73E-01 (Median) | Methylation in Control | 7.68E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg07276388) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.84E+00 | Statistic Test | p-value: 3.47E-20; Z-score: -3.59E+00 | ||
|
Methylation in Case |
3.31E-01 (Median) | Methylation in Control | 6.08E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16867817) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.66E+00 | Statistic Test | p-value: 1.12E-17; Z-score: -2.70E+00 | ||
|
Methylation in Case |
3.98E-01 (Median) | Methylation in Control | 6.61E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01421830) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 1.47E-16; Z-score: -4.54E+00 | ||
|
Methylation in Case |
3.98E-01 (Median) | Methylation in Control | 5.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg25202943) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.53E+00 | Statistic Test | p-value: 3.23E-15; Z-score: -2.95E+00 | ||
|
Methylation in Case |
3.69E-01 (Median) | Methylation in Control | 5.66E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02595575) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.83E+00 | Statistic Test | p-value: 1.29E-14; Z-score: 2.37E+00 | ||
|
Methylation in Case |
4.56E-01 (Median) | Methylation in Control | 2.50E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02902412) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 2.56E-14; Z-score: 1.56E+00 | ||
|
Methylation in Case |
7.40E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg13678205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 8.83E-14; Z-score: -3.02E+00 | ||
|
Methylation in Case |
4.43E-01 (Median) | Methylation in Control | 6.20E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05686323) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 1.48E-11; Z-score: -1.88E+00 | ||
|
Methylation in Case |
4.02E-01 (Median) | Methylation in Control | 5.45E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg15022049) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 3.18E-11; Z-score: -5.68E+00 | ||
|
Methylation in Case |
6.98E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05626764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.85E+00 | Statistic Test | p-value: 1.02E-10; Z-score: 7.18E+00 | ||
|
Methylation in Case |
1.74E-01 (Median) | Methylation in Control | 3.59E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01746503) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 2.71E-10; Z-score: -3.91E+00 | ||
|
Methylation in Case |
6.56E-01 (Median) | Methylation in Control | 8.15E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg18101022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.00E+00 | Statistic Test | p-value: 1.32E-09; Z-score: 3.14E+00 | ||
|
Methylation in Case |
2.46E-01 (Median) | Methylation in Control | 1.23E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg22179256) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 1.46E-09; Z-score: -5.62E+00 | ||
|
Methylation in Case |
6.33E-01 (Median) | Methylation in Control | 7.76E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg06866655) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.71E-09; Z-score: -5.61E+00 | ||
|
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 9.46E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16329782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 2.54E-09; Z-score: -2.33E+00 | ||
|
Methylation in Case |
5.85E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg22800242) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 4.40E-09; Z-score: -4.25E+00 | ||
|
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg00190355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.58E+00 | Statistic Test | p-value: 4.87E-09; Z-score: -1.78E+00 | ||
|
Methylation in Case |
2.38E-01 (Median) | Methylation in Control | 3.74E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16149930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 5.53E-09; Z-score: -3.09E+00 | ||
|
Methylation in Case |
7.76E-01 (Median) | Methylation in Control | 8.40E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg18666982) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 8.20E-09; Z-score: -1.70E+00 | ||
|
Methylation in Case |
7.15E-01 (Median) | Methylation in Control | 8.15E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05169099) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 1.31E-08; Z-score: -2.83E+00 | ||
|
Methylation in Case |
6.93E-01 (Median) | Methylation in Control | 7.94E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg25518170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 1.33E-08; Z-score: -2.46E+00 | ||
|
Methylation in Case |
5.59E-01 (Median) | Methylation in Control | 6.86E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg25925473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.27E-08; Z-score: -3.80E+00 | ||
|
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 8.30E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16555556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 3.12E-08; Z-score: -2.06E+00 | ||
|
Methylation in Case |
4.29E-01 (Median) | Methylation in Control | 5.53E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg04181066) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 3.56E-08; Z-score: -1.61E+00 | ||
|
Methylation in Case |
4.49E-01 (Median) | Methylation in Control | 5.67E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02354563) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.56E+00 | Statistic Test | p-value: 4.89E-08; Z-score: -2.26E+00 | ||
|
Methylation in Case |
2.46E-01 (Median) | Methylation in Control | 3.84E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01103582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 1.04E-07; Z-score: -2.29E+00 | ||
|
Methylation in Case |
5.98E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg06019590) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 1.25E-07; Z-score: -2.14E+00 | ||
|
Methylation in Case |
3.72E-01 (Median) | Methylation in Control | 5.04E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16264495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.83E-07; Z-score: -3.28E+00 | ||
|
Methylation in Case |
7.80E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg21271026) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.86E-07; Z-score: -6.90E-01 | ||
|
Methylation in Case |
7.51E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg10690829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 3.62E-07; Z-score: -1.94E+00 | ||
|
Methylation in Case |
5.59E-01 (Median) | Methylation in Control | 6.78E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 4.28E-07; Z-score: -1.08E+00 | ||
|
Methylation in Case |
7.37E-01 (Median) | Methylation in Control | 8.58E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg08909608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 4.35E-07; Z-score: -1.55E+00 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 45 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg23361356) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.12E-06; Z-score: -2.02E+00 | ||
|
Methylation in Case |
8.65E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 46 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg12437197) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.61E-06; Z-score: -1.99E+00 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.72E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 47 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01181940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 1.79E-06; Z-score: -1.74E+00 | ||
|
Methylation in Case |
3.59E-01 (Median) | Methylation in Control | 4.19E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 48 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16235679) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.14E-06; Z-score: -1.33E+00 | ||
|
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 8.30E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 49 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg15640734) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.02E-06; Z-score: -1.72E+00 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.70E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 50 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16651552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 1.14E-05; Z-score: -1.54E+00 | ||
|
Methylation in Case |
5.63E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 51 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01228410) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 1.48E-05; Z-score: -9.32E-01 | ||
|
Methylation in Case |
5.43E-01 (Median) | Methylation in Control | 6.38E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 52 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg08758174) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 5.05E-05; Z-score: -7.03E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.53E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 53 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg25084851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 5.44E-05; Z-score: -1.26E+00 | ||
|
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 54 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg18447419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 5.67E-05; Z-score: -9.30E-01 | ||
|
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 55 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg15084390) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 6.88E-05; Z-score: 4.40E-01 | ||
|
Methylation in Case |
1.28E-01 (Median) | Methylation in Control | 1.09E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 56 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg21625146) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 1.75E-04; Z-score: -1.43E+00 | ||
|
Methylation in Case |
5.27E-01 (Median) | Methylation in Control | 5.85E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 57 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg06852942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 2.39E-04; Z-score: -7.57E-01 | ||
|
Methylation in Case |
8.26E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 58 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16034787) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.53E-04; Z-score: -5.17E-01 | ||
|
Methylation in Case |
9.48E-01 (Median) | Methylation in Control | 9.56E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 59 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg22689016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 3.05E-04; Z-score: -1.23E+00 | ||
|
Methylation in Case |
3.79E-01 (Median) | Methylation in Control | 4.79E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 60 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg20402284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 3.52E-04; Z-score: -1.21E+00 | ||
|
Methylation in Case |
6.40E-01 (Median) | Methylation in Control | 7.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 61 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg21159260) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 4.63E-04; Z-score: -6.93E-01 | ||
|
Methylation in Case |
4.28E-01 (Median) | Methylation in Control | 4.71E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 62 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg13013644) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 5.46E-04; Z-score: -8.16E-01 | ||
|
Methylation in Case |
5.79E-01 (Median) | Methylation in Control | 6.20E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 63 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg19107578) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 6.01E-04; Z-score: -1.33E+00 | ||
|
Methylation in Case |
5.20E-01 (Median) | Methylation in Control | 5.97E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 64 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg19980199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 7.07E-04; Z-score: -5.26E-01 | ||
|
Methylation in Case |
6.52E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 65 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg09434603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.38E+00 | Statistic Test | p-value: 7.79E-04; Z-score: -1.05E+00 | ||
|
Methylation in Case |
5.79E-01 (Median) | Methylation in Control | 7.97E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 66 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg11360755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 8.58E-04; Z-score: -7.29E-01 | ||
|
Methylation in Case |
6.08E-01 (Median) | Methylation in Control | 6.57E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 67 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02689506) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.05E-03; Z-score: 2.54E-01 | ||
|
Methylation in Case |
1.37E-01 (Median) | Methylation in Control | 1.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 68 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg12833872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.39E-03; Z-score: -3.92E-01 | ||
|
Methylation in Case |
6.67E-01 (Median) | Methylation in Control | 6.93E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 69 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg20558230) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 3.12E-03; Z-score: -8.84E-01 | ||
|
Methylation in Case |
6.35E-01 (Median) | Methylation in Control | 6.80E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 70 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg13340126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 4.73E-03; Z-score: -9.21E-01 | ||
|
Methylation in Case |
5.13E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 71 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01295188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 5.32E-03; Z-score: -2.56E-01 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 72 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg21743597) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.02E-02; Z-score: -1.66E-01 | ||
|
Methylation in Case |
1.57E-01 (Median) | Methylation in Control | 1.63E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 73 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 1.53E-02; Z-score: -3.38E-01 | ||
|
Methylation in Case |
4.40E-02 (Median) | Methylation in Control | 5.12E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 74 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg19301897) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 3.84E-02; Z-score: 5.25E-01 | ||
|
Methylation in Case |
5.16E-01 (Median) | Methylation in Control | 4.65E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 75 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg18140071) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.30E-02; Z-score: -6.21E-02 | ||
|
Methylation in Case |
7.94E-01 (Median) | Methylation in Control | 7.98E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 76 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.44E+00 | Statistic Test | p-value: 2.14E-17; Z-score: -5.84E+00 | ||
|
Methylation in Case |
5.48E-01 (Median) | Methylation in Control | 7.90E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 77 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg14022794) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.61E+00 | Statistic Test | p-value: 3.72E-16; Z-score: -3.34E+00 | ||
|
Methylation in Case |
1.86E-01 (Median) | Methylation in Control | 2.99E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 78 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg21880222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 2.37E-10; Z-score: -4.13E+00 | ||
|
Methylation in Case |
7.20E-01 (Median) | Methylation in Control | 8.09E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
62 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg11964564) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.55E+00 | Statistic Test | p-value: 3.80E-17; Z-score: 1.68E+00 | ||
|
Methylation in Case |
1.17E-01 (Median) | Methylation in Control | 7.53E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg04529938) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 4.39E-10; Z-score: -1.49E+00 | ||
|
Methylation in Case |
3.39E-01 (Median) | Methylation in Control | 4.78E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg23370213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 6.83E-06; Z-score: 7.18E-01 | ||
|
Methylation in Case |
1.63E-01 (Median) | Methylation in Control | 1.18E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg09012125) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.57E+00 | Statistic Test | p-value: 1.76E-05; Z-score: 1.51E+00 | ||
|
Methylation in Case |
6.65E-01 (Median) | Methylation in Control | 4.22E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg16314862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 6.99E-05; Z-score: -7.81E-01 | ||
|
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg11913615) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.54E+00 | Statistic Test | p-value: 6.76E-04; Z-score: -9.66E-01 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 1.98E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg10328297) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 6.70E-03; Z-score: 7.09E-01 | ||
|
Methylation in Case |
6.17E-01 (Median) | Methylation in Control | 5.89E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg00394021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 1.95E-02; Z-score: -5.41E-01 | ||
|
Methylation in Case |
1.40E-01 (Median) | Methylation in Control | 1.73E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg16380351) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.38E-02; Z-score: 2.75E-01 | ||
|
Methylation in Case |
5.24E-02 (Median) | Methylation in Control | 4.97E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg01879556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 4.25E-02; Z-score: 3.86E-01 | ||
|
Methylation in Case |
7.24E-01 (Median) | Methylation in Control | 7.04E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg25611254) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 4.65E-16; Z-score: -2.59E+00 | ||
|
Methylation in Case |
2.27E-01 (Median) | Methylation in Control | 3.20E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg18624900) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.83E+00 | Statistic Test | p-value: 2.13E-15; Z-score: 2.13E+00 | ||
|
Methylation in Case |
2.18E-01 (Median) | Methylation in Control | 1.20E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg24924779) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.98E+00 | Statistic Test | p-value: 7.84E-13; Z-score: 2.63E+00 | ||
|
Methylation in Case |
3.07E-01 (Median) | Methylation in Control | 1.03E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg13980799) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 2.96E-09; Z-score: 2.05E+00 | ||
|
Methylation in Case |
5.17E-01 (Median) | Methylation in Control | 4.23E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg16105558) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 7.32E-08; Z-score: 4.30E-01 | ||
|
Methylation in Case |
9.54E-02 (Median) | Methylation in Control | 8.42E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg21163960) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.43E+00 | Statistic Test | p-value: 1.28E-07; Z-score: 1.00E+00 | ||
|
Methylation in Case |
1.11E-01 (Median) | Methylation in Control | 7.76E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg06594281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.81E+00 | Statistic Test | p-value: 1.36E-06; Z-score: -1.68E+00 | ||
|
Methylation in Case |
1.06E-01 (Median) | Methylation in Control | 4.03E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg26263477) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 1.27E-03; Z-score: -4.69E-01 | ||
|
Methylation in Case |
1.06E-01 (Median) | Methylation in Control | 1.22E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg13411038) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.37E-02; Z-score: -4.54E-01 | ||
|
Methylation in Case |
3.55E-02 (Median) | Methylation in Control | 4.01E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg08944080) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 4.60E-02; Z-score: -5.51E-01 | ||
|
Methylation in Case |
5.28E-02 (Median) | Methylation in Control | 5.78E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg10615414) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 5.49E+00 | Statistic Test | p-value: 1.46E-13; Z-score: 2.66E+00 | ||
|
Methylation in Case |
3.51E-01 (Median) | Methylation in Control | 6.38E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg03790908) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.53E+00 | Statistic Test | p-value: 4.73E-13; Z-score: 1.86E+00 | ||
|
Methylation in Case |
8.50E-02 (Median) | Methylation in Control | 5.57E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg06979771) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 2.02E-07; Z-score: 1.46E+00 | ||
|
Methylation in Case |
6.00E-01 (Median) | Methylation in Control | 5.16E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg13188098) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 8.86E-07; Z-score: 8.67E-01 | ||
|
Methylation in Case |
3.90E-01 (Median) | Methylation in Control | 2.85E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg03892045) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.26E+00 | Statistic Test | p-value: 1.06E-05; Z-score: -1.35E+00 | ||
|
Methylation in Case |
1.04E-01 (Median) | Methylation in Control | 3.41E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg04963424) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 2.37E-04; Z-score: 9.38E-01 | ||
|
Methylation in Case |
3.82E-01 (Median) | Methylation in Control | 3.00E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg01050423) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 1.66E-03; Z-score: -3.76E-01 | ||
|
Methylation in Case |
9.42E-02 (Median) | Methylation in Control | 1.09E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg00917899) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 2.42E-03; Z-score: -7.41E-01 | ||
|
Methylation in Case |
3.19E-02 (Median) | Methylation in Control | 4.19E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg15488402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 6.40E-03; Z-score: -5.14E-01 | ||
|
Methylation in Case |
7.78E-02 (Median) | Methylation in Control | 8.55E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
1stExon (cg22049569) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.85E+00 | Statistic Test | p-value: 1.47E-08; Z-score: 1.93E+00 | ||
|
Methylation in Case |
2.55E-01 (Median) | Methylation in Control | 5.26E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
1stExon (cg08209133) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 6.60E-07; Z-score: 5.47E-01 | ||
|
Methylation in Case |
3.16E-01 (Median) | Methylation in Control | 2.92E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
1stExon (cg13348944) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 7.10E-07; Z-score: 1.85E+00 | ||
|
Methylation in Case |
5.87E-01 (Median) | Methylation in Control | 5.37E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg23475112) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 2.35E-34; Z-score: -7.50E+00 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg20663852) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -4.70E+00 | Statistic Test | p-value: 8.65E-16; Z-score: -3.47E+00 | ||
|
Methylation in Case |
1.25E-01 (Median) | Methylation in Control | 5.86E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg01650904) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.79E+00 | Statistic Test | p-value: 1.86E-14; Z-score: 2.39E+00 | ||
|
Methylation in Case |
3.90E-01 (Median) | Methylation in Control | 2.17E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg17403817) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.72E-13; Z-score: -1.93E+00 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg26247525) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.47E+00 | Statistic Test | p-value: 1.06E-10; Z-score: 2.04E+00 | ||
|
Methylation in Case |
2.52E-01 (Median) | Methylation in Control | 1.02E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg04424119) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 9.29E-09; Z-score: -1.11E+00 | ||
|
Methylation in Case |
4.65E-01 (Median) | Methylation in Control | 5.54E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg09699039) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.82E+00 | Statistic Test | p-value: 1.21E-08; Z-score: 1.89E+00 | ||
|
Methylation in Case |
3.36E-01 (Median) | Methylation in Control | 1.19E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg15520443) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.01E+00 | Statistic Test | p-value: 2.03E-08; Z-score: -1.64E+00 | ||
|
Methylation in Case |
2.26E-01 (Median) | Methylation in Control | 4.55E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg08854366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 3.12E-08; Z-score: 1.56E+00 | ||
|
Methylation in Case |
8.80E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg05960911) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 3.84E-08; Z-score: 1.79E+00 | ||
|
Methylation in Case |
5.91E-01 (Median) | Methylation in Control | 5.19E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg15089806) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 3.41E-06; Z-score: -1.28E+00 | ||
|
Methylation in Case |
6.30E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg12619347) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 4.52E-06; Z-score: 1.38E+00 | ||
|
Methylation in Case |
6.79E-01 (Median) | Methylation in Control | 5.56E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 45 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg00783525) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.17E-05; Z-score: -7.65E-01 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 46 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg16194319) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.36E-05; Z-score: 4.27E-01 | ||
|
Methylation in Case |
4.84E-02 (Median) | Methylation in Control | 4.52E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 47 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg02793415) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.72E-05; Z-score: 1.22E+00 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 48 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg13720865) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.19E-05; Z-score: 1.22E+00 | ||
|
Methylation in Case |
6.10E-01 (Median) | Methylation in Control | 5.70E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 49 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg17493839) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 7.15E-05; Z-score: -5.89E-01 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.53E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 50 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg07196069) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 7.58E-05; Z-score: -1.12E+00 | ||
|
Methylation in Case |
1.49E-01 (Median) | Methylation in Control | 1.85E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 51 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg15284635) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.60E-04; Z-score: 6.07E-01 | ||
|
Methylation in Case |
4.94E-01 (Median) | Methylation in Control | 4.74E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 52 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg09226986) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 2.31E-04; Z-score: 1.18E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 5.92E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 53 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg19631651) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 5.69E-04; Z-score: -6.12E-01 | ||
|
Methylation in Case |
6.81E-01 (Median) | Methylation in Control | 7.16E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 54 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg21534940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 7.94E-04; Z-score: -5.32E-01 | ||
|
Methylation in Case |
5.83E-01 (Median) | Methylation in Control | 6.17E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 55 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg14140691) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 8.84E-04; Z-score: -1.08E+00 | ||
|
Methylation in Case |
4.31E-01 (Median) | Methylation in Control | 4.73E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 56 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg23221540) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.84E-03; Z-score: 4.77E-01 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 57 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg05654361) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 5.24E-03; Z-score: 9.25E-01 | ||
|
Methylation in Case |
7.55E-01 (Median) | Methylation in Control | 7.24E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 58 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg23719549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 6.84E-03; Z-score: -4.21E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 59 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg25165501) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 2.10E-02; Z-score: 5.50E-02 | ||
|
Methylation in Case |
7.44E-01 (Median) | Methylation in Control | 7.42E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 60 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg20049422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 2.45E-02; Z-score: -7.02E-01 | ||
|
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 8.02E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 61 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg02902915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.26E-07; Z-score: -1.32E+00 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.80E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 62 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg01574364) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 2.47E-02; Z-score: 8.58E-01 | ||
|
Methylation in Case |
7.20E-01 (Median) | Methylation in Control | 6.53E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
24 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
5'UTR (cg26119806) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.61E+00 | Statistic Test | p-value: 5.61E-04; Z-score: -4.46E+00 | ||
|
Methylation in Case |
4.22E-01 (Median) | Methylation in Control | 6.78E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
5'UTR (cg00546005) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.08E+00 | Statistic Test | p-value: 3.60E-03; Z-score: 4.05E+00 | ||
|
Methylation in Case |
5.83E-01 (Median) | Methylation in Control | 2.81E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
5'UTR (cg21154627) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.22E+00 | Statistic Test | p-value: 2.16E-02; Z-score: 4.38E+00 | ||
|
Methylation in Case |
1.81E-01 (Median) | Methylation in Control | 8.15E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg13202751) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.31E+00 | Statistic Test | p-value: 7.57E-05; Z-score: 7.94E+00 | ||
|
Methylation in Case |
6.54E-01 (Median) | Methylation in Control | 2.82E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg04433322) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 3.70E-03; Z-score: -4.67E+00 | ||
|
Methylation in Case |
4.28E-01 (Median) | Methylation in Control | 5.62E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg14778169) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 3.20E-02; Z-score: -1.55E+00 | ||
|
Methylation in Case |
1.84E-01 (Median) | Methylation in Control | 2.41E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg01183122) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 3.52E-02; Z-score: 3.76E+00 | ||
|
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg18646365) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.42E+00 | Statistic Test | p-value: 4.34E-02; Z-score: 2.46E+00 | ||
|
Methylation in Case |
4.64E-01 (Median) | Methylation in Control | 3.28E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg17933226) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 4.63E-02; Z-score: -1.82E+00 | ||
|
Methylation in Case |
5.08E-01 (Median) | Methylation in Control | 6.67E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS200 (cg13272818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.93E+00 | Statistic Test | p-value: 1.53E-02; Z-score: 9.41E+00 | ||
|
Methylation in Case |
4.94E-01 (Median) | Methylation in Control | 2.56E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
1stExon (cg25014117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 1.93E-02; Z-score: 2.11E+00 | ||
|
Methylation in Case |
6.91E-02 (Median) | Methylation in Control | 5.79E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg14453449) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 4.83E-04; Z-score: 4.89E+00 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg05031424) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 1.42E-03; Z-score: 3.40E+00 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 8.15E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg15668533) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.22E+00 | Statistic Test | p-value: 9.60E-03; Z-score: 1.43E+01 | ||
|
Methylation in Case |
6.17E-01 (Median) | Methylation in Control | 2.77E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg12146829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.41E+00 | Statistic Test | p-value: 2.06E-02; Z-score: 3.19E+00 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 5.64E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg00240734) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.63E+00 | Statistic Test | p-value: 2.39E-02; Z-score: 5.20E+00 | ||
|
Methylation in Case |
1.82E-01 (Median) | Methylation in Control | 1.12E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg19117051) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 2.62E-02; Z-score: -2.35E+00 | ||
|
Methylation in Case |
3.26E-01 (Median) | Methylation in Control | 4.44E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg18317999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 3.36E-02; Z-score: 1.51E+00 | ||
|
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg17133183) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.16E+00 | Statistic Test | p-value: 3.91E-02; Z-score: -1.67E+00 | ||
|
Methylation in Case |
7.71E-02 (Median) | Methylation in Control | 1.66E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg15527515) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 3.95E-02; Z-score: 2.27E+00 | ||
|
Methylation in Case |
9.03E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg10594510) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 4.57E-02; Z-score: 1.58E+00 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 7.45E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.51E+00 | Statistic Test | p-value: 4.81E-02; Z-score: 2.99E+00 | ||
|
Methylation in Case |
5.80E-01 (Median) | Methylation in Control | 3.84E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg17044311) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 4.89E-02; Z-score: 1.55E+00 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
89 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg09822697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.57E+00 | Statistic Test | p-value: 2.97E-04; Z-score: 6.03E+00 | ||
|
Methylation in Case |
2.62E-01 (Median) | Methylation in Control | 1.67E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg10528482) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 1.07E-03; Z-score: -2.28E+00 | ||
|
Methylation in Case |
5.08E-01 (Median) | Methylation in Control | 6.44E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
TSS200 (cg12628145) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.88E+00 | Statistic Test | p-value: 1.78E-03; Z-score: 3.68E+00 | ||
|
Methylation in Case |
8.67E-02 (Median) | Methylation in Control | 3.01E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
TSS200 (cg25861340) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.76E+00 | Statistic Test | p-value: 2.17E-03; Z-score: 1.68E+00 | ||
|
Methylation in Case |
1.03E-01 (Median) | Methylation in Control | 5.85E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
1stExon (cg02748539) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.24E+00 | Statistic Test | p-value: 4.56E-08; Z-score: 1.72E+01 | ||
|
Methylation in Case |
4.10E-01 (Median) | Methylation in Control | 1.83E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg10430011) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.03E+00 | Statistic Test | p-value: 1.04E-14; Z-score: -4.22E+01 | ||
|
Methylation in Case |
2.45E-01 (Median) | Methylation in Control | 7.41E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg23326234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.94E+00 | Statistic Test | p-value: 2.07E-13; Z-score: -1.55E+01 | ||
|
Methylation in Case |
4.04E-01 (Median) | Methylation in Control | 7.82E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg13641012) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.63E+00 | Statistic Test | p-value: 5.69E-13; Z-score: -1.56E+01 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg19640581) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.26E+00 | Statistic Test | p-value: 1.09E-12; Z-score: -1.39E+01 | ||
|
Methylation in Case |
3.04E-01 (Median) | Methylation in Control | 6.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg00190355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.58E+00 | Statistic Test | p-value: 8.62E-12; Z-score: -1.41E+01 | ||
|
Methylation in Case |
2.00E-01 (Median) | Methylation in Control | 5.15E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01181940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.79E+00 | Statistic Test | p-value: 1.10E-11; Z-score: -1.20E+01 | ||
|
Methylation in Case |
2.59E-01 (Median) | Methylation in Control | 4.63E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg17958577) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.55E+00 | Statistic Test | p-value: 2.25E-11; Z-score: -9.18E+00 | ||
|
Methylation in Case |
5.02E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg22572362) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.92E+00 | Statistic Test | p-value: 2.66E-11; Z-score: -1.40E+01 | ||
|
Methylation in Case |
1.62E-01 (Median) | Methylation in Control | 4.71E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg10655629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.51E+00 | Statistic Test | p-value: 4.97E-11; Z-score: -9.10E+00 | ||
|
Methylation in Case |
4.84E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01295188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.09E+00 | Statistic Test | p-value: 1.35E-10; Z-score: -9.18E+00 | ||
|
Methylation in Case |
3.02E-01 (Median) | Methylation in Control | 6.31E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16555556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.58E+00 | Statistic Test | p-value: 2.46E-10; Z-score: -9.42E+00 | ||
|
Methylation in Case |
3.83E-01 (Median) | Methylation in Control | 6.06E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg19969104) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.59E+00 | Statistic Test | p-value: 4.81E-10; Z-score: -9.19E+00 | ||
|
Methylation in Case |
4.01E-01 (Median) | Methylation in Control | 6.36E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg14533753) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.07E+00 | Statistic Test | p-value: 6.87E-10; Z-score: -8.52E+00 | ||
|
Methylation in Case |
3.11E-01 (Median) | Methylation in Control | 6.43E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg06852942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.68E+00 | Statistic Test | p-value: 7.98E-10; Z-score: -1.67E+01 | ||
|
Methylation in Case |
4.14E-01 (Median) | Methylation in Control | 6.97E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg13004635) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.98E+00 | Statistic Test | p-value: 1.38E-09; Z-score: -7.80E+00 | ||
|
Methylation in Case |
3.27E-01 (Median) | Methylation in Control | 6.49E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg02354563) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.34E+00 | Statistic Test | p-value: 1.97E-09; Z-score: -8.20E+00 | ||
|
Methylation in Case |
1.35E-01 (Median) | Methylation in Control | 3.16E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01982873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 3.54E-09; Z-score: -1.59E+01 | ||
|
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg08904373) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.51E+00 | Statistic Test | p-value: 7.41E-09; Z-score: -1.07E+01 | ||
|
Methylation in Case |
5.66E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg08758174) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.52E+00 | Statistic Test | p-value: 1.61E-08; Z-score: -1.75E+01 | ||
|
Methylation in Case |
5.89E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg15420634) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 1.98E-08; Z-score: -8.85E+00 | ||
|
Methylation in Case |
4.80E-01 (Median) | Methylation in Control | 6.28E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg09647867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.65E+00 | Statistic Test | p-value: 3.66E-08; Z-score: -7.07E+00 | ||
|
Methylation in Case |
4.12E-01 (Median) | Methylation in Control | 6.81E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg06925438) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 4.56E-08; Z-score: -9.96E+00 | ||
|
Methylation in Case |
5.62E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16235679) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.38E+00 | Statistic Test | p-value: 1.06E-07; Z-score: -1.02E+01 | ||
|
Methylation in Case |
5.88E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg14491776) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.65E+00 | Statistic Test | p-value: 1.09E-07; Z-score: -2.98E+01 | ||
|
Methylation in Case |
5.75E-01 (Median) | Methylation in Control | 9.49E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg18666982) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 1.30E-07; Z-score: -7.69E+00 | ||
|
Methylation in Case |
6.14E-01 (Median) | Methylation in Control | 8.30E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg10690829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.93E+00 | Statistic Test | p-value: 1.40E-07; Z-score: -6.42E+00 | ||
|
Methylation in Case |
3.00E-01 (Median) | Methylation in Control | 5.81E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg19107578) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.63E+00 | Statistic Test | p-value: 3.39E-07; Z-score: -6.87E+00 | ||
|
Methylation in Case |
3.14E-01 (Median) | Methylation in Control | 5.12E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01103582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.62E+00 | Statistic Test | p-value: 3.62E-07; Z-score: -9.50E+00 | ||
|
Methylation in Case |
4.29E-01 (Median) | Methylation in Control | 6.94E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg04764584) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.65E+00 | Statistic Test | p-value: 4.44E-07; Z-score: -5.16E+00 | ||
|
Methylation in Case |
2.30E-01 (Median) | Methylation in Control | 3.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg22689016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.10E+00 | Statistic Test | p-value: 4.94E-07; Z-score: -7.00E+00 | ||
|
Methylation in Case |
2.64E-01 (Median) | Methylation in Control | 5.54E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg21159260) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.66E+00 | Statistic Test | p-value: 7.94E-07; Z-score: -5.37E+00 | ||
|
Methylation in Case |
2.57E-01 (Median) | Methylation in Control | 4.27E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+01 | Statistic Test | p-value: 1.09E-06; Z-score: 2.85E+01 | ||
|
Methylation in Case |
3.13E-01 (Median) | Methylation in Control | 2.42E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg17778888) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.97E+00 | Statistic Test | p-value: 1.84E-06; Z-score: -5.03E+00 | ||
|
Methylation in Case |
4.53E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg10634702) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 2.11E-06; Z-score: -1.20E+01 | ||
|
Methylation in Case |
7.36E-01 (Median) | Methylation in Control | 8.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg25346936) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.72E+00 | Statistic Test | p-value: 2.26E-06; Z-score: -1.42E+01 | ||
|
Methylation in Case |
2.43E-01 (Median) | Methylation in Control | 4.19E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg12507879) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 2.35E-06; Z-score: -6.96E+00 | ||
|
Methylation in Case |
7.80E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg24632646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.59E+00 | Statistic Test | p-value: 2.85E-06; Z-score: -4.39E+00 | ||
|
Methylation in Case |
3.17E-01 (Median) | Methylation in Control | 5.04E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg21620524) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 3.08E-06; Z-score: -6.36E+00 | ||
|
Methylation in Case |
6.24E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg14137381) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.87E+00 | Statistic Test | p-value: 4.67E-06; Z-score: 5.21E+00 | ||
|
Methylation in Case |
7.03E-01 (Median) | Methylation in Control | 3.75E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 45 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg18140071) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 4.83E-06; Z-score: -3.80E+00 | ||
|
Methylation in Case |
4.40E-01 (Median) | Methylation in Control | 6.21E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 46 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16535035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 6.12E-06; Z-score: -7.85E+00 | ||
|
Methylation in Case |
6.86E-01 (Median) | Methylation in Control | 7.98E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 47 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg26710738) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 6.23E-06; Z-score: -8.33E+00 | ||
|
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 48 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg04181066) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 1.29E-05; Z-score: -3.33E+00 | ||
|
Methylation in Case |
4.82E-01 (Median) | Methylation in Control | 6.52E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 49 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg07834249) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.44E-05; Z-score: -3.62E+00 | ||
|
Methylation in Case |
7.31E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 50 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg05981741) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 1.64E-05; Z-score: -4.36E+00 | ||
|
Methylation in Case |
7.24E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 51 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg26086288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 1.88E-05; Z-score: -5.14E+00 | ||
|
Methylation in Case |
7.09E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 52 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg19426594) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.50E+00 | Statistic Test | p-value: 2.51E-05; Z-score: -5.02E+00 | ||
|
Methylation in Case |
5.13E-01 (Median) | Methylation in Control | 7.72E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 53 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg12833872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.82E+00 | Statistic Test | p-value: 2.52E-05; Z-score: -4.79E+00 | ||
|
Methylation in Case |
2.43E-01 (Median) | Methylation in Control | 4.42E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 54 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg23551873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 3.79E-05; Z-score: -3.48E+00 | ||
|
Methylation in Case |
7.27E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 55 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg21625146) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.65E+00 | Statistic Test | p-value: 5.27E-05; Z-score: -4.09E+00 | ||
|
Methylation in Case |
3.30E-01 (Median) | Methylation in Control | 5.43E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 56 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg21271026) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 5.69E-05; Z-score: -4.31E+00 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 57 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 6.50E-05; Z-score: -4.55E+00 | ||
|
Methylation in Case |
7.55E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 58 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg06866655) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 7.46E-05; Z-score: -1.24E+01 | ||
|
Methylation in Case |
8.26E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 59 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg18274791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 9.64E-05; Z-score: -1.79E+01 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 9.74E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 60 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01316792) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.02E-04; Z-score: -3.52E+00 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 61 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg22985016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.37E+00 | Statistic Test | p-value: 1.17E-04; Z-score: -5.39E+00 | ||
|
Methylation in Case |
5.41E-01 (Median) | Methylation in Control | 7.43E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 62 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg25518170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.46E+00 | Statistic Test | p-value: 1.43E-04; Z-score: -2.99E+00 | ||
|
Methylation in Case |
3.65E-01 (Median) | Methylation in Control | 5.33E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 63 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16264495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.51E-04; Z-score: -3.51E+00 | ||
|
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 64 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg11083715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 1.65E-04; Z-score: -4.89E+00 | ||
|
Methylation in Case |
4.72E-01 (Median) | Methylation in Control | 6.13E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 65 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg19980199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 2.07E-04; Z-score: -3.38E+00 | ||
|
Methylation in Case |
5.37E-01 (Median) | Methylation in Control | 6.73E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 66 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16149930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 2.92E-04; Z-score: -3.21E+00 | ||
|
Methylation in Case |
6.59E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 67 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg02009040) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.30E-04; Z-score: -2.72E+00 | ||
|
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 8.42E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 68 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg06483795) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 3.70E-04; Z-score: -4.61E+00 | ||
|
Methylation in Case |
6.44E-01 (Median) | Methylation in Control | 8.01E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 69 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg06058576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.50E+00 | Statistic Test | p-value: 7.69E-04; Z-score: -3.95E+00 | ||
|
Methylation in Case |
5.57E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 70 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01377305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.57E+00 | Statistic Test | p-value: 8.05E-04; Z-score: 6.60E+00 | ||
|
Methylation in Case |
1.14E-01 (Median) | Methylation in Control | 7.22E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 71 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg06019590) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.51E+00 | Statistic Test | p-value: 1.43E-03; Z-score: -2.96E+00 | ||
|
Methylation in Case |
2.59E-01 (Median) | Methylation in Control | 3.93E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 72 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg20558230) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 3.40E-03; Z-score: -2.87E+00 | ||
|
Methylation in Case |
6.81E-01 (Median) | Methylation in Control | 7.56E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 73 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg20402284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 3.51E-03; Z-score: -2.31E+00 | ||
|
Methylation in Case |
3.73E-01 (Median) | Methylation in Control | 4.65E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 74 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg08909608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 3.73E-03; Z-score: -2.03E+00 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 9.09E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 75 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg05169099) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 3.90E-03; Z-score: -2.41E+00 | ||
|
Methylation in Case |
4.99E-01 (Median) | Methylation in Control | 6.67E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 76 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16651552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 4.38E-03; Z-score: -2.03E+00 | ||
|
Methylation in Case |
6.10E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 77 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg23361356) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 6.10E-03; Z-score: -2.54E+00 | ||
|
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 78 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg12437197) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 6.26E-03; Z-score: -1.61E+00 | ||
|
Methylation in Case |
9.65E-01 (Median) | Methylation in Control | 9.78E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 79 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg11360755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 7.28E-03; Z-score: 3.01E+00 | ||
|
Methylation in Case |
7.45E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 80 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg08894629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 7.87E-03; Z-score: 1.09E+00 | ||
|
Methylation in Case |
1.12E-01 (Median) | Methylation in Control | 9.91E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 81 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16329782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 7.89E-03; Z-score: -2.36E+00 | ||
|
Methylation in Case |
4.74E-01 (Median) | Methylation in Control | 5.39E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 82 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg13340126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.72E+00 | Statistic Test | p-value: 9.35E-03; Z-score: -2.21E+00 | ||
|
Methylation in Case |
1.08E-01 (Median) | Methylation in Control | 2.95E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 83 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16034787) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.91E-02; Z-score: -1.98E+00 | ||
|
Methylation in Case |
9.46E-01 (Median) | Methylation in Control | 9.57E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 84 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg18096398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.00E-02; Z-score: -2.55E+00 | ||
|
Methylation in Case |
9.51E-01 (Median) | Methylation in Control | 9.68E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 85 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg18447419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 2.63E-02; Z-score: -1.64E+00 | ||
|
Methylation in Case |
5.45E-01 (Median) | Methylation in Control | 6.99E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 86 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg15124303) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 2.78E-02; Z-score: 1.81E+00 | ||
|
Methylation in Case |
2.13E-01 (Median) | Methylation in Control | 1.74E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 87 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01228410) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 3.02E-02; Z-score: -2.25E+00 | ||
|
Methylation in Case |
5.63E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 88 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg22800242) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.35E-02; Z-score: -6.63E-01 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 89 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg22025206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 4.46E-02; Z-score: 2.56E+00 | ||
|
Methylation in Case |
4.80E-01 (Median) | Methylation in Control | 3.93E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
79 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg09822697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.09E+00 | Statistic Test | p-value: 1.07E-20; Z-score: 5.44E+00 | ||
|
Methylation in Case |
3.37E-01 (Median) | Methylation in Control | 1.61E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg23061578) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 1.11E-06; Z-score: 1.21E+00 | ||
|
Methylation in Case |
1.85E-01 (Median) | Methylation in Control | 1.49E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
TSS200 (cg25861340) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.16E+00 | Statistic Test | p-value: 2.50E-09; Z-score: 1.80E+00 | ||
|
Methylation in Case |
9.81E-02 (Median) | Methylation in Control | 4.53E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
TSS200 (cg12628145) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.72E+00 | Statistic Test | p-value: 8.25E-09; Z-score: 2.23E+00 | ||
|
Methylation in Case |
1.17E-01 (Median) | Methylation in Control | 4.31E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
1stExon (cg02748539) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.81E+00 | Statistic Test | p-value: 5.98E-21; Z-score: 4.60E+00 | ||
|
Methylation in Case |
3.09E-01 (Median) | Methylation in Control | 1.71E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16651552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 3.15E-14; Z-score: -2.39E+00 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 6.75E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16535035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 3.00E-12; Z-score: -2.23E+00 | ||
|
Methylation in Case |
6.95E-01 (Median) | Methylation in Control | 7.76E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg14533753) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 2.18E-11; Z-score: -2.34E+00 | ||
|
Methylation in Case |
4.92E-01 (Median) | Methylation in Control | 5.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg10634702) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 3.74E-11; Z-score: -2.78E+00 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 8.56E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg20558230) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 6.25E-11; Z-score: -1.84E+00 | ||
|
Methylation in Case |
6.08E-01 (Median) | Methylation in Control | 7.35E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg15124303) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.57E+00 | Statistic Test | p-value: 1.41E-10; Z-score: 2.47E+00 | ||
|
Methylation in Case |
2.23E-01 (Median) | Methylation in Control | 1.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg25518170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.42E+00 | Statistic Test | p-value: 3.02E-10; Z-score: 2.41E+00 | ||
|
Methylation in Case |
5.35E-01 (Median) | Methylation in Control | 3.77E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg19107578) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.39E+00 | Statistic Test | p-value: 1.87E-09; Z-score: 1.74E+00 | ||
|
Methylation in Case |
4.57E-01 (Median) | Methylation in Control | 3.29E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg11083715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 3.16E-09; Z-score: -1.63E+00 | ||
|
Methylation in Case |
4.88E-01 (Median) | Methylation in Control | 6.01E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg20402284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 8.75E-09; Z-score: 1.89E+00 | ||
|
Methylation in Case |
5.44E-01 (Median) | Methylation in Control | 4.12E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg22800242) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.17E-08; Z-score: -1.75E+00 | ||
|
Methylation in Case |
7.79E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg23251141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 2.83E-08; Z-score: 2.86E+00 | ||
|
Methylation in Case |
4.43E-01 (Median) | Methylation in Control | 3.58E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg17958577) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 2.92E-08; Z-score: -1.89E+00 | ||
|
Methylation in Case |
6.12E-01 (Median) | Methylation in Control | 6.85E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.76E+00 | Statistic Test | p-value: 3.94E-08; Z-score: 1.87E+00 | ||
|
Methylation in Case |
5.07E-02 (Median) | Methylation in Control | 1.35E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg01982873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 4.40E-08; Z-score: -1.59E+00 | ||
|
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg13641012) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 7.29E-08; Z-score: -1.70E+00 | ||
|
Methylation in Case |
7.52E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg23551873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 3.51E-07; Z-score: -1.61E+00 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg06852942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.30E+00 | Statistic Test | p-value: 4.46E-07; Z-score: 1.81E+00 | ||
|
Methylation in Case |
6.36E-01 (Median) | Methylation in Control | 4.91E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg21620524) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.76E-07; Z-score: -1.32E+00 | ||
|
Methylation in Case |
6.79E-01 (Median) | Methylation in Control | 7.22E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg12507879) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 5.57E-07; Z-score: -1.15E+00 | ||
|
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 8.33E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 7.19E-07; Z-score: -1.68E+00 | ||
|
Methylation in Case |
7.46E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg01316792) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.21E-06; Z-score: -1.31E+00 | ||
|
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg06925438) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.53E-06; Z-score: -1.64E+00 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg04181066) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.65E-06; Z-score: -1.28E+00 | ||
|
Methylation in Case |
6.32E-01 (Median) | Methylation in Control | 6.93E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg19980199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 3.94E-06; Z-score: 1.79E+00 | ||
|
Methylation in Case |
6.71E-01 (Median) | Methylation in Control | 5.69E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg12833872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.30E+00 | Statistic Test | p-value: 5.91E-06; Z-score: 1.43E+00 | ||
|
Methylation in Case |
3.95E-01 (Median) | Methylation in Control | 3.05E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg07834249) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 1.18E-05; Z-score: -1.26E+00 | ||
|
Methylation in Case |
6.94E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16149930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.60E-05; Z-score: -5.87E-01 | ||
|
Methylation in Case |
7.45E-01 (Median) | Methylation in Control | 7.68E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg15084390) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 1.79E-05; Z-score: 7.00E-01 | ||
|
Methylation in Case |
8.89E-02 (Median) | Methylation in Control | 7.69E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16555556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 1.89E-05; Z-score: -1.15E+00 | ||
|
Methylation in Case |
4.88E-01 (Median) | Methylation in Control | 5.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg14137381) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 2.13E-05; Z-score: 1.06E+00 | ||
|
Methylation in Case |
2.90E-01 (Median) | Methylation in Control | 2.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg22985016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 2.56E-05; Z-score: -1.40E+00 | ||
|
Methylation in Case |
4.75E-01 (Median) | Methylation in Control | 6.04E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg02009040) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.83E-05; Z-score: -1.34E+00 | ||
|
Methylation in Case |
7.98E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg05981741) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 3.49E-05; Z-score: -1.19E+00 | ||
|
Methylation in Case |
7.61E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg01295188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 4.14E-05; Z-score: 1.47E+00 | ||
|
Methylation in Case |
6.67E-01 (Median) | Methylation in Control | 5.32E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg21743597) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 4.27E-05; Z-score: 1.10E+00 | ||
|
Methylation in Case |
1.78E-01 (Median) | Methylation in Control | 1.46E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg10655629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 5.35E-05; Z-score: 1.52E+00 | ||
|
Methylation in Case |
6.60E-01 (Median) | Methylation in Control | 5.88E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg25925473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 9.30E-05; Z-score: -1.05E+00 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg04764584) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 9.76E-05; Z-score: -7.40E-01 | ||
|
Methylation in Case |
2.96E-01 (Median) | Methylation in Control | 3.28E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 45 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg19301897) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 1.09E-04; Z-score: 2.99E-01 | ||
|
Methylation in Case |
1.16E-01 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 46 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg26086288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.48E-04; Z-score: -8.18E-01 | ||
|
Methylation in Case |
7.52E-01 (Median) | Methylation in Control | 7.91E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 47 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg13340126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 2.00E-04; Z-score: 3.45E-01 | ||
|
Methylation in Case |
1.30E-01 (Median) | Methylation in Control | 1.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 48 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg01377305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.23E+00 | Statistic Test | p-value: 2.29E-04; Z-score: 7.12E-01 | ||
|
Methylation in Case |
8.65E-02 (Median) | Methylation in Control | 7.06E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 49 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16264495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.90E-04; Z-score: -1.14E+00 | ||
|
Methylation in Case |
7.50E-01 (Median) | Methylation in Control | 8.00E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 50 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg25346936) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 3.84E-04; Z-score: 1.27E+00 | ||
|
Methylation in Case |
4.60E-01 (Median) | Methylation in Control | 3.76E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 51 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg21271026) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.10E-04; Z-score: -7.20E-01 | ||
|
Methylation in Case |
7.67E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 52 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg06866655) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.42E-04; Z-score: -5.89E-01 | ||
|
Methylation in Case |
8.77E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 53 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg08894629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 5.13E-04; Z-score: 8.06E-01 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 1.12E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 54 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg01103582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 5.27E-04; Z-score: -6.05E-01 | ||
|
Methylation in Case |
6.23E-01 (Median) | Methylation in Control | 6.44E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 55 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16235679) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 7.95E-04; Z-score: 8.68E-01 | ||
|
Methylation in Case |
7.70E-01 (Median) | Methylation in Control | 7.06E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 56 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg22572362) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 1.07E-03; Z-score: 5.50E-01 | ||
|
Methylation in Case |
2.82E-01 (Median) | Methylation in Control | 2.36E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 57 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg23361356) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.08E-03; Z-score: -4.39E-01 | ||
|
Methylation in Case |
8.85E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 58 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg00190355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 1.15E-03; Z-score: -1.06E+00 | ||
|
Methylation in Case |
3.27E-01 (Median) | Methylation in Control | 4.03E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 59 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg15420634) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.82E-03; Z-score: -7.62E-01 | ||
|
Methylation in Case |
5.13E-01 (Median) | Methylation in Control | 5.48E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 60 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg13004635) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 2.18E-03; Z-score: 9.96E-01 | ||
|
Methylation in Case |
6.62E-01 (Median) | Methylation in Control | 6.14E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 61 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg09647867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.27E-03; Z-score: -8.91E-01 | ||
|
Methylation in Case |
5.60E-01 (Median) | Methylation in Control | 5.89E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 62 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg23326234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.62E-03; Z-score: -6.12E-01 | ||
|
Methylation in Case |
5.55E-01 (Median) | Methylation in Control | 5.85E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 63 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg22689016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 3.97E-03; Z-score: -9.28E-01 | ||
|
Methylation in Case |
3.22E-01 (Median) | Methylation in Control | 4.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 64 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg08758174) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 4.40E-03; Z-score: 1.20E+00 | ||
|
Methylation in Case |
8.19E-01 (Median) | Methylation in Control | 7.23E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 65 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg10690829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.82E-03; Z-score: -4.85E-01 | ||
|
Methylation in Case |
4.63E-01 (Median) | Methylation in Control | 4.92E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 66 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg02689506) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 6.93E-03; Z-score: 2.41E-01 | ||
|
Methylation in Case |
9.64E-02 (Median) | Methylation in Control | 9.16E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 67 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg08904373) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 8.48E-03; Z-score: -8.78E-01 | ||
|
Methylation in Case |
6.84E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 68 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg06483795) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 1.10E-02; Z-score: -9.60E-01 | ||
|
Methylation in Case |
6.46E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 69 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg14491776) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.54E+00 | Statistic Test | p-value: 1.24E-02; Z-score: -9.66E-01 | ||
|
Methylation in Case |
6.08E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 70 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg18096398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 1.76E-02; Z-score: -8.33E-01 | ||
|
Methylation in Case |
7.40E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 71 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg24632646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.02E-02; Z-score: -2.24E-01 | ||
|
Methylation in Case |
4.39E-01 (Median) | Methylation in Control | 4.54E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 72 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg18274791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.08E-02; Z-score: -2.53E-01 | ||
|
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 9.52E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 73 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg10430011) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 2.12E-02; Z-score: -1.12E+00 | ||
|
Methylation in Case |
4.82E-01 (Median) | Methylation in Control | 5.96E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 74 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16034787) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.23E-02; Z-score: -6.06E-01 | ||
|
Methylation in Case |
9.27E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 75 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg17778888) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 4.22E-02; Z-score: 7.83E-01 | ||
|
Methylation in Case |
5.50E-01 (Median) | Methylation in Control | 4.57E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 76 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg13013644) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 4.41E-02; Z-score: -7.26E-01 | ||
|
Methylation in Case |
4.85E-01 (Median) | Methylation in Control | 5.47E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 77 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg22025206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 4.79E-02; Z-score: 4.61E-01 | ||
|
Methylation in Case |
3.65E-01 (Median) | Methylation in Control | 3.36E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 78 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg15640734) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 4.92E-02; Z-score: -2.75E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.64E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 79 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg01228410) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 4.93E-02; Z-score: -6.14E-01 | ||
|
Methylation in Case |
5.19E-01 (Median) | Methylation in Control | 6.33E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
50 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg09822697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.84E+00 | Statistic Test | p-value: 2.48E-07; Z-score: 1.94E+00 | ||
|
Methylation in Case |
2.19E-01 (Median) | Methylation in Control | 1.19E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
1stExon (cg02748539) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.60E+00 | Statistic Test | p-value: 4.12E-07; Z-score: 1.79E+00 | ||
|
Methylation in Case |
1.99E-01 (Median) | Methylation in Control | 1.25E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg01316792) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 4.38E-15; Z-score: 2.99E+00 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 7.38E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg27624327) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.48E+00 | Statistic Test | p-value: 2.88E-10; Z-score: 4.34E+00 | ||
|
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 6.11E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg16651552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 6.68E-10; Z-score: -2.44E+00 | ||
|
Methylation in Case |
7.69E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg01181940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.37E+00 | Statistic Test | p-value: 2.06E-09; Z-score: -3.97E+00 | ||
|
Methylation in Case |
4.64E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg23251141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 1.65E-08; Z-score: 3.80E+00 | ||
|
Methylation in Case |
6.30E-01 (Median) | Methylation in Control | 4.90E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg16329782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 1.43E-07; Z-score: 2.93E+00 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 6.36E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg20558230) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 1.67E-07; Z-score: -2.04E+00 | ||
|
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg19107578) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 3.62E-07; Z-score: 3.99E+00 | ||
|
Methylation in Case |
6.28E-01 (Median) | Methylation in Control | 4.98E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg17958577) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.42E-06; Z-score: -2.60E+00 | ||
|
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg18447419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 1.43E-06; Z-score: 2.66E+00 | ||
|
Methylation in Case |
9.39E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg11083715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.47E-06; Z-score: -2.08E+00 | ||
|
Methylation in Case |
7.85E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg25925473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.20E-06; Z-score: 6.76E-01 | ||
|
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.00E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg08894629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.77E+00 | Statistic Test | p-value: 5.39E-06; Z-score: 2.16E+00 | ||
|
Methylation in Case |
6.43E-02 (Median) | Methylation in Control | 3.63E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.30E-05; Z-score: -2.09E+00 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg12833872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.42E+00 | Statistic Test | p-value: 1.49E-05; Z-score: 1.48E+00 | ||
|
Methylation in Case |
3.34E-01 (Median) | Methylation in Control | 2.36E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg16535035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 5.31E-05; Z-score: -1.33E+00 | ||
|
Methylation in Case |
8.95E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg01377305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.45E+00 | Statistic Test | p-value: 1.07E-04; Z-score: 1.52E+00 | ||
|
Methylation in Case |
3.63E-02 (Median) | Methylation in Control | 2.51E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg21159260) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 1.08E-04; Z-score: -1.47E+00 | ||
|
Methylation in Case |
4.92E-01 (Median) | Methylation in Control | 5.67E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg22572362) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.39E+00 | Statistic Test | p-value: 1.17E-04; Z-score: 1.31E+00 | ||
|
Methylation in Case |
2.53E-01 (Median) | Methylation in Control | 1.81E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg25518170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 4.09E-04; Z-score: 3.26E+00 | ||
|
Methylation in Case |
8.34E-01 (Median) | Methylation in Control | 6.82E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg01103582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 4.18E-04; Z-score: -1.43E+00 | ||
|
Methylation in Case |
8.22E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg17778888) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 5.24E-04; Z-score: 1.61E+00 | ||
|
Methylation in Case |
9.66E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg19301897) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 5.47E-04; Z-score: 7.20E-01 | ||
|
Methylation in Case |
4.52E-02 (Median) | Methylation in Control | 3.64E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg06925438) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 8.87E-04; Z-score: -1.12E+00 | ||
|
Methylation in Case |
9.23E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg02354563) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 9.87E-04; Z-score: 1.16E+00 | ||
|
Methylation in Case |
3.03E-01 (Median) | Methylation in Control | 2.42E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg21620524) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.53E-03; Z-score: -4.53E-01 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg20402284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 1.78E-03; Z-score: 3.28E+00 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 6.80E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg13340126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.23E+00 | Statistic Test | p-value: 1.84E-03; Z-score: 5.01E-01 | ||
|
Methylation in Case |
7.74E-02 (Median) | Methylation in Control | 6.28E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg01982873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.88E-03; Z-score: -5.54E-01 | ||
|
Methylation in Case |
9.44E-01 (Median) | Methylation in Control | 9.49E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg16034787) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.97E-03; Z-score: -5.43E-01 | ||
|
Methylation in Case |
9.74E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg19969104) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 2.06E-03; Z-score: 2.66E+00 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.66E+00 | Statistic Test | p-value: 3.67E-03; Z-score: 9.13E-01 | ||
|
Methylation in Case |
2.37E-02 (Median) | Methylation in Control | 1.43E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg11360755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 3.80E-03; Z-score: 1.68E+00 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 7.83E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg21743597) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 3.83E-03; Z-score: -1.39E+00 | ||
|
Methylation in Case |
2.99E-01 (Median) | Methylation in Control | 3.97E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg22985016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 4.02E-03; Z-score: 1.33E+00 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg16235679) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.06E-03; Z-score: -1.18E+00 | ||
|
Methylation in Case |
9.41E-01 (Median) | Methylation in Control | 9.53E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg22025206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 6.02E-03; Z-score: 1.59E+00 | ||
|
Methylation in Case |
5.65E-01 (Median) | Methylation in Control | 4.39E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg23551873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.16E-02; Z-score: -1.14E+00 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.60E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg23361356) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.37E-02; Z-score: -8.97E-01 | ||
|
Methylation in Case |
9.75E-01 (Median) | Methylation in Control | 9.79E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg10634702) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.72E-02; Z-score: -1.26E+00 | ||
|
Methylation in Case |
9.60E-01 (Median) | Methylation in Control | 9.73E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg21625146) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 2.69E-02; Z-score: -1.20E+00 | ||
|
Methylation in Case |
6.01E-01 (Median) | Methylation in Control | 6.52E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg10690829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 2.78E-02; Z-score: 1.76E+00 | ||
|
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 7.05E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 45 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg07834249) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.81E-02; Z-score: -6.25E-01 | ||
|
Methylation in Case |
9.30E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 46 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg05169099) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.23E-02; Z-score: -4.97E-02 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 9.14E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 47 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg04764584) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 3.48E-02; Z-score: -1.48E+00 | ||
|
Methylation in Case |
3.49E-01 (Median) | Methylation in Control | 4.04E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 48 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg22689016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 4.01E-02; Z-score: -2.49E-01 | ||
|
Methylation in Case |
5.88E-01 (Median) | Methylation in Control | 6.07E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 49 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg16555556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.04E-02; Z-score: 1.53E+00 | ||
|
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 7.19E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 50 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg15084390) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 4.58E-02; Z-score: -1.28E+00 | ||
|
Methylation in Case |
2.63E-01 (Median) | Methylation in Control | 3.55E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
45 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg10528482) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 3.20E-07; Z-score: 1.85E+00 | ||
|
Methylation in Case |
7.55E-01 (Median) | Methylation in Control | 5.90E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg09822697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.23E+00 | Statistic Test | p-value: 9.58E-04; Z-score: 5.62E-01 | ||
|
Methylation in Case |
3.42E-01 (Median) | Methylation in Control | 2.78E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
TSS200 (cg25861340) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 2.10E-02; Z-score: 1.14E-01 | ||
|
Methylation in Case |
6.24E-02 (Median) | Methylation in Control | 4.86E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
1stExon (cg02748539) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 3.59E-04; Z-score: 8.55E-01 | ||
|
Methylation in Case |
4.25E-01 (Median) | Methylation in Control | 3.35E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg05981741) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 7.62E-07; Z-score: -2.05E+00 | ||
|
Methylation in Case |
9.09E-01 (Median) | Methylation in Control | 9.28E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg06058576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 2.85E-06; Z-score: -1.52E+00 | ||
|
Methylation in Case |
5.80E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16535035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 7.97E-06; Z-score: -1.94E+00 | ||
|
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg23326234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.47E-05; Z-score: -1.39E+00 | ||
|
Methylation in Case |
8.38E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.71E-05; Z-score: -1.61E+00 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg21271026) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 5.20E-05; Z-score: 1.24E+00 | ||
|
Methylation in Case |
8.93E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg10655629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.43E+00 | Statistic Test | p-value: 5.32E-05; Z-score: 1.56E+00 | ||
|
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 5.30E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg23551873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.19E-04; Z-score: -9.90E-01 | ||
|
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.49E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg01316792) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.40E-04; Z-score: -5.99E-01 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg02354563) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 2.03E-04; Z-score: 9.99E-01 | ||
|
Methylation in Case |
4.54E-01 (Median) | Methylation in Control | 3.72E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg06019590) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.35E+00 | Statistic Test | p-value: 3.03E-04; Z-score: 1.15E+00 | ||
|
Methylation in Case |
6.00E-01 (Median) | Methylation in Control | 4.43E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg26710738) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 4.40E-04; Z-score: -1.00E+00 | ||
|
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 6.69E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.45E+00 | Statistic Test | p-value: 5.07E-04; Z-score: 6.98E-01 | ||
|
Methylation in Case |
7.23E-02 (Median) | Methylation in Control | 2.95E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16264495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 5.27E-04; Z-score: -1.10E+00 | ||
|
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 9.36E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg06852942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.38E+00 | Statistic Test | p-value: 6.66E-04; Z-score: 1.55E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 5.41E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg08904373) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 6.82E-04; Z-score: 9.85E-01 | ||
|
Methylation in Case |
7.14E-01 (Median) | Methylation in Control | 5.72E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg26086288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.00E-03; Z-score: -4.23E-01 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg02009040) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.29E-03; Z-score: -1.60E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.38E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg25925473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.58E-03; Z-score: -4.27E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg23251141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 1.74E-03; Z-score: 1.17E+00 | ||
|
Methylation in Case |
6.02E-01 (Median) | Methylation in Control | 4.80E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg22985016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.46E+00 | Statistic Test | p-value: 1.87E-03; Z-score: 1.06E+00 | ||
|
Methylation in Case |
5.88E-01 (Median) | Methylation in Control | 4.04E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg12507879) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.32E-03; Z-score: -5.17E-01 | ||
|
Methylation in Case |
8.95E-01 (Median) | Methylation in Control | 9.11E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg27624327) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.13E-03; Z-score: -8.10E-01 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg06866655) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.66E-03; Z-score: -4.06E-01 | ||
|
Methylation in Case |
9.52E-01 (Median) | Methylation in Control | 9.56E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg05169099) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 4.69E-03; Z-score: -5.44E-01 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg18140071) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 5.92E-03; Z-score: -6.60E-01 | ||
|
Methylation in Case |
9.17E-01 (Median) | Methylation in Control | 9.35E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg21620524) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 6.51E-03; Z-score: -5.69E-01 | ||
|
Methylation in Case |
8.91E-01 (Median) | Methylation in Control | 8.98E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16555556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 6.78E-03; Z-score: 1.12E+00 | ||
|
Methylation in Case |
6.67E-01 (Median) | Methylation in Control | 5.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg25346936) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.31E+00 | Statistic Test | p-value: 9.48E-03; Z-score: 1.20E+00 | ||
|
Methylation in Case |
5.67E-01 (Median) | Methylation in Control | 4.34E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg22800242) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 1.11E-02; Z-score: 2.46E-03 | ||
|
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16651552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.15E-02; Z-score: -4.40E-01 | ||
|
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg21159260) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.24E-02; Z-score: 7.34E-01 | ||
|
Methylation in Case |
5.97E-01 (Median) | Methylation in Control | 5.27E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg11083715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.34E-02; Z-score: -7.11E-01 | ||
|
Methylation in Case |
7.80E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg09647867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.38E-02; Z-score: -5.79E-01 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg18447419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.52E+00 | Statistic Test | p-value: 1.40E-02; Z-score: 1.28E+00 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 4.99E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg15420634) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.49E-02; Z-score: -7.42E-03 | ||
|
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 8.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg10634702) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.92E-02; Z-score: -2.81E-01 | ||
|
Methylation in Case |
9.38E-01 (Median) | Methylation in Control | 9.42E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg08909608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.47E-02; Z-score: -4.68E-01 | ||
|
Methylation in Case |
9.16E-01 (Median) | Methylation in Control | 9.23E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16329782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 4.00E-02; Z-score: 9.16E-01 | ||
|
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 6.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg11360755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 4.37E-02; Z-score: 5.97E-01 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
27 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg09822697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.59E+00 | Statistic Test | p-value: 5.35E-03; Z-score: 4.52E+00 | ||
|
Methylation in Case |
3.53E-01 (Median) | Methylation in Control | 2.22E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg12628145) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.02E+00 | Statistic Test | p-value: 3.75E-02; Z-score: 3.41E+00 | ||
|
Methylation in Case |
1.53E-01 (Median) | Methylation in Control | 7.58E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg25861340) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.65E+00 | Statistic Test | p-value: 4.06E-02; Z-score: 3.10E+00 | ||
|
Methylation in Case |
1.79E-01 (Median) | Methylation in Control | 1.09E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
1stExon (cg02748539) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.69E+00 | Statistic Test | p-value: 1.67E-03; Z-score: 4.15E+00 | ||
|
Methylation in Case |
3.89E-01 (Median) | Methylation in Control | 2.30E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg19301897) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.59E+00 | Statistic Test | p-value: 7.53E-04; Z-score: 1.48E+00 | ||
|
Methylation in Case |
4.06E-01 (Median) | Methylation in Control | 2.56E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg02354563) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 9.11E-04; Z-score: 2.40E+00 | ||
|
Methylation in Case |
4.72E-01 (Median) | Methylation in Control | 3.88E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg20558230) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 2.36E-03; Z-score: -6.66E+00 | ||
|
Methylation in Case |
6.12E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg11083715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 4.85E-03; Z-score: -2.23E+00 | ||
|
Methylation in Case |
6.53E-01 (Median) | Methylation in Control | 7.14E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg06483795) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 6.70E-03; Z-score: -2.13E+00 | ||
|
Methylation in Case |
8.22E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg13340126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 7.10E-03; Z-score: 1.78E+00 | ||
|
Methylation in Case |
4.70E-01 (Median) | Methylation in Control | 3.86E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg01181940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 7.50E-03; Z-score: -1.46E+00 | ||
|
Methylation in Case |
4.68E-01 (Median) | Methylation in Control | 5.16E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg13004635) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 1.01E-02; Z-score: 4.80E+00 | ||
|
Methylation in Case |
7.50E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.34E+00 | Statistic Test | p-value: 1.20E-02; Z-score: 4.62E+00 | ||
|
Methylation in Case |
1.54E-01 (Median) | Methylation in Control | 6.60E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg13641012) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.32E-02; Z-score: -3.39E+00 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 8.89E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg16034787) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.55E-02; Z-score: -1.58E+00 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.53E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg20402284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 2.45E-02; Z-score: 1.90E+00 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg19107578) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 2.95E-02; Z-score: 2.34E+00 | ||
|
Methylation in Case |
6.40E-01 (Median) | Methylation in Control | 5.32E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg06058576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.16E-02; Z-score: 2.48E+00 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 3.89E-02; Z-score: -6.44E+00 | ||
|
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg18447419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 4.07E-02; Z-score: 1.75E+00 | ||
|
Methylation in Case |
9.04E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg12833872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 4.11E-02; Z-score: 1.41E+00 | ||
|
Methylation in Case |
6.56E-01 (Median) | Methylation in Control | 5.98E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg18274791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.56E-02; Z-score: -2.48E+00 | ||
|
Methylation in Case |
9.54E-01 (Median) | Methylation in Control | 9.69E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg14491776) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 4.65E-02; Z-score: -2.79E+00 | ||
|
Methylation in Case |
8.35E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg08904373) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.67E-02; Z-score: 1.65E+00 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 7.61E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg18096398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.68E-02; Z-score: -5.37E+00 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.62E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg16535035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.90E-02; Z-score: -2.08E+00 | ||
|
Methylation in Case |
7.61E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg01228410) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 4.95E-02; Z-score: -7.13E-01 | ||
|
Methylation in Case |
6.46E-01 (Median) | Methylation in Control | 6.71E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
28 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg09822697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 3.32E-02; Z-score: 2.29E-01 | ||
|
Methylation in Case |
1.21E-01 (Median) | Methylation in Control | 1.14E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
TSS200 (cg12628145) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 1.63E-02; Z-score: 5.07E-01 | ||
|
Methylation in Case |
7.62E-02 (Median) | Methylation in Control | 6.88E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg02009040) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.56E-12; Z-score: -1.97E+00 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg16535035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 2.44E-12; Z-score: -2.16E+00 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg21620524) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 4.29E-12; Z-score: -1.88E+00 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg06483795) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 7.18E-10; Z-score: -1.56E+00 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.07E-08; Z-score: -1.66E+00 | ||
|
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg01316792) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.23E-07; Z-score: -9.13E-01 | ||
|
Methylation in Case |
8.45E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg16651552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 4.06E-06; Z-score: -1.12E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg21271026) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.34E-04; Z-score: -8.36E-01 | ||
|
Methylation in Case |
8.10E-01 (Median) | Methylation in Control | 8.42E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg25084851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 2.58E-04; Z-score: 1.21E+00 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg18447419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 2.66E-04; Z-score: 8.24E-01 | ||
|
Methylation in Case |
5.59E-01 (Median) | Methylation in Control | 4.92E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg23251141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 2.71E-04; Z-score: 8.60E-01 | ||
|
Methylation in Case |
2.87E-01 (Median) | Methylation in Control | 2.47E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg22025206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 7.12E-04; Z-score: -1.29E+00 | ||
|
Methylation in Case |
3.34E-01 (Median) | Methylation in Control | 4.41E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg10690829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 3.79E-03; Z-score: 9.41E-01 | ||
|
Methylation in Case |
7.82E-01 (Median) | Methylation in Control | 7.34E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg12507879) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 5.85E-03; Z-score: -4.01E-01 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 9.17E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg18274791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 6.38E-03; Z-score: -3.82E-01 | ||
|
Methylation in Case |
9.51E-01 (Median) | Methylation in Control | 9.54E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg20558230) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 7.93E-03; Z-score: -3.76E-01 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg15420634) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 9.78E-03; Z-score: -3.39E-01 | ||
|
Methylation in Case |
6.47E-01 (Median) | Methylation in Control | 6.60E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg01228410) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.72E-02; Z-score: -5.79E-01 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg06866655) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.99E-02; Z-score: -2.18E-01 | ||
|
Methylation in Case |
8.86E-01 (Median) | Methylation in Control | 8.89E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg06058576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 2.17E-02; Z-score: 3.16E-01 | ||
|
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.23E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg17958577) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.18E-02; Z-score: -7.76E-01 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg16264495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.70E-02; Z-score: -3.62E-01 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.98E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg26086288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.60E-02; Z-score: -6.20E-01 | ||
|
Methylation in Case |
8.60E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 3.65E-02; Z-score: 3.01E-01 | ||
|
Methylation in Case |
5.34E-02 (Median) | Methylation in Control | 4.97E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg19426594) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.25E-02; Z-score: -1.62E-01 | ||
|
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg07834249) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.86E-02; Z-score: -3.69E-01 | ||
|
Methylation in Case |
8.72E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Celiac disease |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC9A3 in celiac disease | [ 11 ] | |||
|
Location |
Body (cg21743597) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.35E+00 | Statistic Test | p-value: 2.29E-02; Z-score: 5.21E-01 | ||
|
Methylation in Case |
1.19E-01 (Median) | Methylation in Control | 8.80E-02 (Median) | ||
|
Studied Phenotype |
Celiac disease [ ICD-11: DA95] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC9A3 in panic disorder | [ 12 ] | |||
|
Location |
Body (cg16264495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.64E-02; Z-score: 4.15E-01 | ||
|
Methylation in Case |
3.38E+00 (Median) | Methylation in Control | 3.17E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC9A3 in panic disorder | [ 12 ] | |||
|
Location |
Body (cg10430011) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 3.21E-02; Z-score: 3.60E-01 | ||
|
Methylation in Case |
3.15E+00 (Median) | Methylation in Control | 2.96E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC9A3 in panic disorder | [ 12 ] | |||
|
Location |
Body (cg01295188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 3.22E-02; Z-score: 5.75E-01 | ||
|
Methylation in Case |
1.92E+00 (Median) | Methylation in Control | 1.67E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Arterial aneurysm |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC9A3 in arterial aneurysm than that in healthy individual | ||||
Studied Phenotype |
Arterial aneurysm [ICD-11:BD51] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.027442308; Fold-change: 0.217233019; Z-score: 2.044728151 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC9A3 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 7.63E-37; Fold-change: 0.560293742; Z-score: 3.117586583 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC9A3 in gastric cancer than that in adjacent tissue | ||||
Studied Phenotype |
Gastric cancer [ICD-11:2B72] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value: 1.12E-94; Fold-change: 0.546083755; Z-score: 143.1369704 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
microRNA |
|||||
|
Unclear Phenotype |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-1199 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1199 | miRNA Mature ID | miR-1199-3p | ||
|
miRNA Sequence |
UGCGGCCGGUGCUCAACCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 2 |
miR-1228 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1228 | miRNA Mature ID | miR-1228-5p | ||
|
miRNA Sequence |
GUGGGCGGGGGCAGGUGUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 3 |
miR-1302 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1302 | miRNA Mature ID | miR-1302 | ||
|
miRNA Sequence |
UUGGGACAUACUUAUGCUAAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 4 |
miR-132 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-132 | miRNA Mature ID | miR-132-5p | ||
|
miRNA Sequence |
ACCGUGGCUUUCGAUUGUUACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 5 |
miR-2277 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-2277 | miRNA Mature ID | miR-2277-5p | ||
|
miRNA Sequence |
AGCGCGGGCUGAGCGCUGCCAGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 6 |
miR-2277 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-2277 | miRNA Mature ID | miR-2277-3p | ||
|
miRNA Sequence |
UGACAGCGCCCUGCCUGGCUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 7 |
miR-3191 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3191 | miRNA Mature ID | miR-3191-3p | ||
|
miRNA Sequence |
UGGGGACGUAGCUGGCCAGACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 8 |
miR-3960 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3960 | miRNA Mature ID | miR-3960 | ||
|
miRNA Sequence |
GGCGGCGGCGGAGGCGGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 9 |
miR-4298 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4298 | miRNA Mature ID | miR-4298 | ||
|
miRNA Sequence |
CUGGGACAGGAGGAGGAGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-4467 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4467 | miRNA Mature ID | miR-4467 | ||
|
miRNA Sequence |
UGGCGGCGGUAGUUAUGGGCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 11 |
miR-4634 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4634 | miRNA Mature ID | miR-4634 | ||
|
miRNA Sequence |
CGGCGCGACCGGCCCGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 12 |
miR-4706 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4706 | miRNA Mature ID | miR-4706 | ||
|
miRNA Sequence |
AGCGGGGAGGAAGUGGGCGCUGCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 13 |
miR-4749 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4749 | miRNA Mature ID | miR-4749-5p | ||
|
miRNA Sequence |
UGCGGGGACAGGCCAGGGCAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 14 |
miR-541 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-541 | miRNA Mature ID | miR-541-3p | ||
|
miRNA Sequence |
UGGUGGGCACAGAAUCUGGACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 15 |
miR-654 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-654 | miRNA Mature ID | miR-654-5p | ||
|
miRNA Sequence |
UGGUGGGCCGCAGAACAUGUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 16 |
miR-6786 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6786 | miRNA Mature ID | miR-6786-5p | ||
|
miRNA Sequence |
GCGGUGGGGCCGGAGGGGCGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 17 |
miR-8072 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8072 | miRNA Mature ID | miR-8072 | ||
|
miRNA Sequence |
GGCGGCGGGGAGGUAGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.