Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0488 Transporter Info
Gene Name	SLC9A4
Transporter Name	Sodium/hydrogen exchanger 4
Gene ID	389015
UniProt ID	Q6AI14

Epigenetic Regulations of This DT (EGR)
Methylation
Pancretic ductal adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg27375012)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.42E-03; Z-score: -5.49E-01
Methylation in Case	9.08E-01 (Median)	Methylation in Control	9.14E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	1stExon (cg13223402)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.13E+00	Statistic Test	p-value: 6.51E-31; Z-score: 1.09E+01
Methylation in Case	1.86E-01 (Median)	Methylation in Control	5.96E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg08876130)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 1.27E-03; Z-score: -1.02E+00
Methylation in Case	2.50E-01 (Median)	Methylation in Control	3.31E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A4 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg10275969)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.46E-03; Z-score: -7.14E-01
Methylation in Case	7.59E-01 (Median)	Methylation in Control	7.92E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A4 in bladder cancer			[ 2 ]
Location	TSS200 (cg04239558)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.63E+00	Statistic Test	p-value: 5.01E-04; Z-score: -3.32E+00
Methylation in Case	9.41E-02 (Median)	Methylation in Control	2.48E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A4 in bladder cancer			[ 2 ]
Location	Body (cg02552255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.78E+00	Statistic Test	p-value: 2.56E-08; Z-score: -1.09E+01
Methylation in Case	3.77E-01 (Median)	Methylation in Control	6.72E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A4 in bladder cancer			[ 2 ]
Location	Body (cg16237262)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.23E-02; Z-score: 2.49E+00
Methylation in Case	8.30E-01 (Median)	Methylation in Control	7.61E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A4 in bladder cancer			[ 2 ]
Location	3'UTR (cg20061812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.93E-04; Z-score: -3.27E+00
Methylation in Case	8.50E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Colorectal cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A4 in colorectal cancer			[ 3 ]
Location	TSS200 (cg05751189)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 3.31E-02; Z-score: 6.52E-01
Methylation in Case	1.72E-01 (Median)	Methylation in Control	1.43E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A4 in colorectal cancer			[ 3 ]
Location	Body (cg02552255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 4.79E-12; Z-score: -2.44E+00
Methylation in Case	6.62E-01 (Median)	Methylation in Control	7.69E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A4 in hepatocellular carcinoma			[ 4 ]
Location	TSS200 (cg10608615)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.65E+00	Statistic Test	p-value: 2.89E-18; Z-score: -5.39E+00
Methylation in Case	3.29E-01 (Median)	Methylation in Control	5.42E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg21620524)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 4.63E-17; Z-score: -6.66E+00
Methylation in Case	5.90E-01 (Median)	Methylation in Control	7.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A4 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg10403518)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 2.57E-08; Z-score: -2.61E+00
Methylation in Case	6.68E-01 (Median)	Methylation in Control	7.70E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Breast cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A4 in breast cancer			[ 5 ]
Location	Body (cg03405781)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 8.80E-08; Z-score: -1.61E+00
Methylation in Case	8.98E-01 (Median)	Methylation in Control	9.33E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A4 in breast cancer			[ 5 ]
Location	Body (cg10403518)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 7.52E-03; Z-score: -5.76E-01
Methylation in Case	7.39E-01 (Median)	Methylation in Control	7.81E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A4 in breast cancer			[ 5 ]
Location	Body (cg02552255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 1.41E-02; Z-score: 7.67E-01
Methylation in Case	4.64E-01 (Median)	Methylation in Control	4.09E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC9A4 in breast cancer			[ 5 ]
Location	3'UTR (cg20061812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 6.93E-03; Z-score: -2.56E-01
Methylation in Case	8.78E-01 (Median)	Methylation in Control	8.84E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A4 in lung adenocarcinoma			[ 6 ]
Location	Body (cg03405781)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 4.02E-03; Z-score: -9.45E+00
Methylation in Case	9.00E-01 (Median)	Methylation in Control	9.49E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A4 in lung adenocarcinoma			[ 6 ]
Location	Body (cg02552255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 6.18E-03; Z-score: -1.66E+00
Methylation in Case	5.49E-01 (Median)	Methylation in Control	6.29E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC9A4 in papillary thyroid cancer			[ 7 ]
Location	Body (cg02552255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 4.52E-10; Z-score: -2.05E+00
Methylation in Case	7.30E-01 (Median)	Methylation in Control	7.88E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC9A4 in papillary thyroid cancer			[ 7 ]
Location	Body (cg16237262)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.75E-02; Z-score: -5.15E-01
Methylation in Case	8.66E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC9A4 in papillary thyroid cancer			[ 7 ]
Location	3'UTR (cg20061812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.36E-02; Z-score: -3.45E-01
Methylation in Case	8.99E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Liver cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant/significant hypermethylation of SLC9A4 in liver cancer than that in healthy individual/adjacent tissue
Studied Phenotype	Liver cancer [ICD-11:2C12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000123451; Fold-change: -0.353722453; Z-score: -1.193346582
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 3.95E-11; Fold-change: -0.370088402; Z-score: -2.850790588
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
Atypical teratoid rhabdoid tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC9A4 in atypical teratoid rhabdoid tumour than that in healthy individual
Studied Phenotype	Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.00357527; Fold-change: -0.24761719; Z-score: -0.844074398
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC9A4 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.001834399; Fold-change: -0.252257802; Z-score: -0.914248722
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC9A4 in prostate cancer than that in healthy individual
Studied Phenotype	Prostate cancer [ICD-11:2C82]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.044895679; Fold-change: 0.307468911; Z-score: 1.126293175
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Chordoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC9A4 in chordoma than that in healthy individual
Studied Phenotype	Chordoma [ICD-11:5A61.0]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.92E-06; Fold-change: -0.497255122; Z-score: -6.897892165
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Esthesioneuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC9A4 in esthesioneuroblastoma than that in healthy individual
Studied Phenotype	Esthesioneuroblastoma [ICD-11:2D50.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.79E-10; Fold-change: -0.790067618; Z-score: -2.359496241
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC9A4 in melanoma than that in healthy individual
Studied Phenotype	Melanoma [ICD-11:2C30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 5.60E-06; Fold-change: -0.472941374; Z-score: -1.606261339
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC9A4 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.16E-12; Fold-change: -0.716012396; Z-score: -2.327814511
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Peripheral neuroectodermal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC9A4 in peripheral neuroectodermal tumour than that in healthy individual
Studied Phenotype	Peripheral neuroectodermal tumour [ICD-11:2B52]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000521221; Fold-change: -0.47907578; Z-score: -1.62943807
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Prostate cancer metastasis	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC9A4 in prostate cancer metastasis than that in healthy individual
Studied Phenotype	Prostate cancer metastasis [ICD-11:2.00E+06]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.013349598; Fold-change: -0.324345406; Z-score: -15.413542
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	32 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-369 directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-369	miRNA Mature ID	miR-369-3p
miRNA Sequence	AAUAAUACAUGGUUGAUCUUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 2	miR-374a directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-374a	miRNA Mature ID	miR-374a-5p
miRNA Sequence	UUAUAAUACAACCUGAUAAGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 3	miR-374b directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-374b	miRNA Mature ID	miR-374b-5p
miRNA Sequence	AUAUAAUACAACCUGCUAAGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 4	miR-548a directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548a	miRNA Mature ID	miR-548a-5p
miRNA Sequence	AAAAGUAAUUGCGAGUUUUACC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 5	miR-548ab directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548ab	miRNA Mature ID	miR-548ab
miRNA Sequence	AAAAGUAAUUGUGGAUUUUGCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 6	miR-548ad directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548ad	miRNA Mature ID	miR-548ad-5p
miRNA Sequence	AAAAGUAAUUGUGGUUUUUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 7	miR-548ae directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548ae	miRNA Mature ID	miR-548ae-5p
miRNA Sequence	AAAAGUAAUUGUGGUUUUUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 8	miR-548ak directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548ak	miRNA Mature ID	miR-548ak
miRNA Sequence	AAAAGUAACUGCGGUUUUUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 9	miR-548am directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548am	miRNA Mature ID	miR-548am-5p
miRNA Sequence	AAAAGUAAUUGCGGUUUUUGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 10	miR-548ap directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548ap	miRNA Mature ID	miR-548ap-5p
miRNA Sequence	AAAAGUAAUUGCGGUCUUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 11	miR-548aq directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548aq	miRNA Mature ID	miR-548aq-5p
miRNA Sequence	GAAAGUAAUUGCUGUUUUUGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 12	miR-548ar directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548ar	miRNA Mature ID	miR-548ar-5p
miRNA Sequence	AAAAGUAAUUGCAGUUUUUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 13	miR-548as directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548as	miRNA Mature ID	miR-548as-5p
miRNA Sequence	AAAAGUAAUUGCGGGUUUUGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 14	miR-548au directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548au	miRNA Mature ID	miR-548au-5p
miRNA Sequence	AAAAGUAAUUGCGGUUUUUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 15	miR-548av directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548av	miRNA Mature ID	miR-548av-5p
miRNA Sequence	AAAAGUACUUGCGGAUUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 16	miR-548ay directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548ay	miRNA Mature ID	miR-548ay-5p
miRNA Sequence	AAAAGUAAUUGUGGUUUUUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 17	miR-548b directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548b	miRNA Mature ID	miR-548b-5p
miRNA Sequence	AAAAGUAAUUGUGGUUUUGGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 18	miR-548bb directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548bb	miRNA Mature ID	miR-548bb-5p
miRNA Sequence	AAAAGUAACUAUGGUUUUUGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 19	miR-548c directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548c	miRNA Mature ID	miR-548c-5p
miRNA Sequence	AAAAGUAAUUGCGGUUUUUGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 20	miR-548d directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548d	miRNA Mature ID	miR-548d-5p
miRNA Sequence	AAAAGUAAUUGUGGUUUUUGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 21	miR-548h directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548h	miRNA Mature ID	miR-548h-5p
miRNA Sequence	AAAAGUAAUCGCGGUUUUUGUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 22	miR-548i directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548i	miRNA Mature ID	miR-548i
miRNA Sequence	AAAAGUAAUUGCGGAUUUUGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 23	miR-548j directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548j	miRNA Mature ID	miR-548j-5p
miRNA Sequence	AAAAGUAAUUGCGGUCUUUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 24	miR-548k directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548k	miRNA Mature ID	miR-548k
miRNA Sequence	AAAAGUACUUGCGGAUUUUGCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 25	miR-548l directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548l	miRNA Mature ID	miR-548l
miRNA Sequence	AAAAGUAUUUGCGGGUUUUGUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 26	miR-548o directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548o	miRNA Mature ID	miR-548o-5p
miRNA Sequence	AAAAGUAAUUGCGGUUUUUGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 27	miR-548w directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548w	miRNA Mature ID	miR-548w
miRNA Sequence	AAAAGUAACUGCGGUUUUUGCCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 28	miR-548y directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548y	miRNA Mature ID	miR-548y
miRNA Sequence	AAAAGUAAUCACUGUUUUUGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 29	miR-559 directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-559	miRNA Mature ID	miR-559
miRNA Sequence	UAAAGUAAAUAUGCACCAAAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 30	miR-5692b directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5692b	miRNA Mature ID	miR-5692b
miRNA Sequence	AAUAAUAUCACAGUAGGUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 31	miR-5692c directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5692c	miRNA Mature ID	miR-5692c
miRNA Sequence	AAUAAUAUCACAGUAGGUGUAC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 32	miR-8054 directly targets SLC9A4			[ 8 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-8054	miRNA Mature ID	miR-8054
miRNA Sequence	GAAAGUACAGAUCGGAUGGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2	DNA Methylation Dynamics in Urological Tumors.
3	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5	Genome-wide Scan for Methylation Profiles in Breast Cancer
6	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8	A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence