Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0490 Transporter Info
Gene Name SLC9A6
Transporter Name Sodium/hydrogen exchanger 6
Gene ID
10479
UniProt ID
Q92581
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

          12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-103a directly targets SLC9A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-103a miRNA Mature ID miR-103a-3p

miRNA Sequence

 AGCAGCAUUGUACAGGGCUAUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-15a directly targets SLC9A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-15a miRNA Mature ID miR-15a-5p

miRNA Sequence

 UAGCAGCACAUAAUGGUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-15b directly targets SLC9A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

 UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-16 directly targets SLC9A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-195 directly targets SLC9A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

 UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-19a directly targets SLC9A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-19a miRNA Mature ID miR-19a-3p

miRNA Sequence

 UGUGCAAAUCUAUGCAAAACUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-19b directly targets SLC9A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

 UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-21 directly targets SLC9A6 [ 3 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-21 miRNA Mature ID miR-21-5p

miRNA Sequence

 UAGCUUAUCAGACUGAUGUUGA

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 miR-23b directly targets SLC9A6 [ 4 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-23b miRNA Mature ID miR-23b-3p

miRNA Sequence

 AUCACAUUGCCAGGGAUUACCAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-31 directly targets SLC9A6 [ 4 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-31 miRNA Mature ID miR-31-3p

miRNA Sequence

 UGCUAUGCCAACAUAUUGCCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-421 directly targets SLC9A6 [ 4 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-421 miRNA Mature ID miR-421

miRNA Sequence

 AUCAACAGACAUUAAUUGGGCGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-93 directly targets SLC9A6 [ 4 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

 CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

Methylation

  Lymphoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC9A6 in lymphoma than that in healthy individual

Studied Phenotype

 Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 3.43E-07; Fold-change: -0.284685061; Z-score: -2.965538813
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Pancreatic cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC9A6 in pancreatic adenocarcinoma than that in healthy individual

Studied Phenotype

 Pancreatic cancer [ICD-11:2C10]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.011015246; Fold-change: -0.316572612; Z-score: -6.864886593
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section
Download DT methylation data in the tissue of healthy individual
References
1 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
2 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
3 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
4 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.