Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0500 Transporter Info
Gene Name	SLCO2A1
Transporter Name	Organic anion transporting polypeptide 2A1
Gene ID	6578
UniProt ID	Q92959

Epigenetic Regulations of This DT (EGR)
Methylation
Hepatocellular carcinoma	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	5'UTR (cg05439503)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.54E+00	Statistic Test	p-value: 1.01E-14; Z-score: -1.80E+00
Methylation in Case	5.00E-01 (Median)	Methylation in Control	7.70E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	TSS1500 (cg10935723)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 1.14E-12; Z-score: -3.30E+00
Methylation in Case	4.88E-01 (Median)	Methylation in Control	6.54E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	TSS1500 (cg07780818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 5.70E-04; Z-score: 2.67E-01
Methylation in Case	1.43E-01 (Median)	Methylation in Control	1.37E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	TSS1500 (cg05430989)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 1.45E-03; Z-score: 7.94E-01
Methylation in Case	2.73E-01 (Median)	Methylation in Control	2.49E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	1stExon (cg06654103)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 6.66E-16; Z-score: -9.72E+00
Methylation in Case	5.91E-01 (Median)	Methylation in Control	8.31E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg12582965)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.65E+00	Statistic Test	p-value: 9.31E-19; Z-score: -5.32E+00
Methylation in Case	4.53E-01 (Median)	Methylation in Control	7.45E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg23210852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.70E+00	Statistic Test	p-value: 1.49E-13; Z-score: 2.01E+00
Methylation in Case	4.29E-01 (Median)	Methylation in Control	2.52E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg11666857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 3.21E-11; Z-score: -3.01E+00
Methylation in Case	5.56E-01 (Median)	Methylation in Control	7.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg10577586)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 5.26E-08; Z-score: -2.37E+00
Methylation in Case	6.69E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg17806191)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.40E-06; Z-score: -7.68E-01
Methylation in Case	8.43E-01 (Median)	Methylation in Control	8.74E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg07562926)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 2.86E-06; Z-score: -1.14E+00
Methylation in Case	6.65E-01 (Median)	Methylation in Control	7.19E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg10351795)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 9.86E-06; Z-score: -1.17E+00
Methylation in Case	7.40E-01 (Median)	Methylation in Control	7.92E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg04900941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 5.33E-05; Z-score: -9.24E-01
Methylation in Case	6.99E-01 (Median)	Methylation in Control	7.39E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg22822824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 3.62E-04; Z-score: 2.54E-01
Methylation in Case	8.61E-02 (Median)	Methylation in Control	7.80E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLCO2A1 in hepatocellular carcinoma			[ 1 ]
Location	3'UTR (cg03988700)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.07E+00	Statistic Test	p-value: 3.57E-19; Z-score: -5.23E+00
Methylation in Case	2.86E-01 (Median)	Methylation in Control	5.91E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	5'UTR (cg04349243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.30E-04; Z-score: -2.62E-01
Methylation in Case	3.11E-01 (Median)	Methylation in Control	3.18E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg13417268)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.92E+00	Statistic Test	p-value: 1.28E-05; Z-score: 1.22E+00
Methylation in Case	1.78E-01 (Median)	Methylation in Control	9.28E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO2A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg24040450)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 2.30E-04; Z-score: -7.00E-01
Methylation in Case	6.88E-01 (Median)	Methylation in Control	7.29E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO2A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg02260363)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 6.76E-03; Z-score: 8.23E-01
Methylation in Case	3.79E-01 (Median)	Methylation in Control	3.46E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO2A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS200 (cg27634724)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 2.51E-05; Z-score: -9.62E-01
Methylation in Case	1.61E-01 (Median)	Methylation in Control	2.01E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO2A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS200 (cg09962807)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.98E-03; Z-score: 1.54E-01
Methylation in Case	6.19E-02 (Median)	Methylation in Control	6.00E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLCO2A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg14474561)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 1.68E-09; Z-score: -1.30E+00
Methylation in Case	4.09E-01 (Median)	Methylation in Control	4.73E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLCO2A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg01103582)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 2.14E-09; Z-score: 1.93E+00
Methylation in Case	7.36E-01 (Median)	Methylation in Control	6.49E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLCO2A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg04470085)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.02E-05; Z-score: -7.35E-01
Methylation in Case	8.46E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLCO2A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg16463165)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 4.86E-05; Z-score: 1.23E+00
Methylation in Case	6.82E-01 (Median)	Methylation in Control	6.34E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLCO2A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg09978546)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 2.01E-03; Z-score: 8.94E-01
Methylation in Case	9.04E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLCO2A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	3'UTR (cg20061812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 8.16E-03; Z-score: -6.55E-01
Methylation in Case	7.57E-01 (Median)	Methylation in Control	8.04E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in bladder cancer			[ 3 ]
Location	TSS1500 (cg05430989)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 2.36E-04; Z-score: -5.21E+00
Methylation in Case	1.30E-01 (Median)	Methylation in Control	1.82E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in bladder cancer			[ 3 ]
Location	Body (cg17065011)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 5.41E-12; Z-score: -1.08E+01
Methylation in Case	4.32E-01 (Median)	Methylation in Control	5.79E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO2A1 in bladder cancer			[ 3 ]
Location	Body (cg04900941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.98E+00	Statistic Test	p-value: 7.93E-12; Z-score: -2.84E+01
Methylation in Case	3.62E-01 (Median)	Methylation in Control	7.17E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO2A1 in bladder cancer			[ 3 ]
Location	Body (cg11282353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -3.06E+00	Statistic Test	p-value: 6.95E-07; Z-score: -6.62E+00
Methylation in Case	1.06E-01 (Median)	Methylation in Control	3.25E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO2A1 in bladder cancer			[ 3 ]
Location	Body (cg10577586)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 2.81E-05; Z-score: -6.06E+00
Methylation in Case	6.03E-01 (Median)	Methylation in Control	7.02E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO2A1 in bladder cancer			[ 3 ]
Location	Body (cg16854533)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 9.80E-05; Z-score: -3.53E+00
Methylation in Case	4.35E-01 (Median)	Methylation in Control	5.79E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLCO2A1 in bladder cancer			[ 3 ]
Location	Body (cg07562926)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+00	Statistic Test	p-value: 1.69E-04; Z-score: -4.06E+00
Methylation in Case	3.98E-01 (Median)	Methylation in Control	6.17E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLCO2A1 in bladder cancer			[ 3 ]
Location	Body (cg17806191)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.59E-03; Z-score: -2.18E+00
Methylation in Case	8.43E-01 (Median)	Methylation in Control	9.01E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLCO2A1 in bladder cancer			[ 3 ]
Location	Body (cg10351795)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 4.39E-03; Z-score: -1.22E+00
Methylation in Case	6.75E-01 (Median)	Methylation in Control	7.10E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLCO2A1 in bladder cancer			[ 3 ]
Location	Body (cg17858406)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.22E-02; Z-score: -2.11E+00
Methylation in Case	8.82E-01 (Median)	Methylation in Control	9.11E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLCO2A1 in bladder cancer			[ 3 ]
Location	Body (cg20388916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 3.63E-02; Z-score: -2.04E+00
Methylation in Case	7.12E-01 (Median)	Methylation in Control	7.77E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	TSS1500 (cg07780818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 6.23E-04; Z-score: 7.96E-01
Methylation in Case	1.11E-01 (Median)	Methylation in Control	9.12E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	TSS1500 (cg05430989)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 2.17E-03; Z-score: 8.16E-01
Methylation in Case	2.41E-01 (Median)	Methylation in Control	2.05E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	Body (cg11282353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.16E+00	Statistic Test	p-value: 1.65E-15; Z-score: -2.39E+00
Methylation in Case	2.06E-01 (Median)	Methylation in Control	4.45E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	Body (cg20388916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 1.07E-11; Z-score: -2.31E+00
Methylation in Case	6.26E-01 (Median)	Methylation in Control	7.29E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	Body (cg10577586)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 9.56E-06; Z-score: -1.12E+00
Methylation in Case	6.76E-01 (Median)	Methylation in Control	7.35E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	Body (cg04900941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.04E-05; Z-score: -1.17E+00
Methylation in Case	7.03E-01 (Median)	Methylation in Control	7.65E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	Body (cg10351795)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.68E-04; Z-score: -8.16E-01
Methylation in Case	7.09E-01 (Median)	Methylation in Control	7.51E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	Body (cg14955235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 4.24E-04; Z-score: -8.81E-01
Methylation in Case	6.57E-01 (Median)	Methylation in Control	7.02E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	Body (cg17065011)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 8.60E-04; Z-score: -9.63E-01
Methylation in Case	4.83E-01 (Median)	Methylation in Control	5.85E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	Body (cg16854533)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 2.16E-03; Z-score: -7.57E-01
Methylation in Case	4.48E-01 (Median)	Methylation in Control	5.26E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	Body (cg07708788)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 9.65E-03; Z-score: 5.28E-01
Methylation in Case	7.14E-02 (Median)	Methylation in Control	6.23E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	Body (cg17858406)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 9.75E-03; Z-score: -3.79E-01
Methylation in Case	9.09E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	Body (cg25598319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 2.08E-02; Z-score: -5.09E-01
Methylation in Case	1.04E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLCO2A1 in breast cancer			[ 4 ]
Location	Body (cg07562926)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 2.32E-02; Z-score: 3.94E-01
Methylation in Case	5.24E-01 (Median)	Methylation in Control	4.86E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg05430989)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.54E+00	Statistic Test	p-value: 8.48E-06; Z-score: 1.63E+00
Methylation in Case	2.03E-01 (Median)	Methylation in Control	1.33E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg07780818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 5.60E-03; Z-score: 3.46E-01
Methylation in Case	4.63E-02 (Median)	Methylation in Control	3.68E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO2A1 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg07708788)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 2.09E-02; Z-score: 4.45E-01
Methylation in Case	3.22E-02 (Median)	Methylation in Control	2.66E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO2A1 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg25598319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 2.19E-02; Z-score: 2.95E-01
Methylation in Case	4.92E-02 (Median)	Methylation in Control	4.35E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO2A1 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg02496728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 3.47E-02; Z-score: 2.07E-01
Methylation in Case	2.04E-02 (Median)	Methylation in Control	1.87E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO2A1 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg22822824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 3.52E-02; Z-score: 2.55E-01
Methylation in Case	3.22E-02 (Median)	Methylation in Control	3.14E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in colon adenocarcinoma			[ 6 ]
Location	TSS1500 (cg23642392)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 6.40E-06; Z-score: -3.90E+00
Methylation in Case	4.88E-01 (Median)	Methylation in Control	6.75E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in colon adenocarcinoma			[ 6 ]
Location	TSS200 (cg09710316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 3.08E-03; Z-score: -1.64E+00
Methylation in Case	7.31E-01 (Median)	Methylation in Control	7.70E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO2A1 in colon adenocarcinoma			[ 6 ]
Location	Body (cg22579691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 9.05E-04; Z-score: 1.88E+00
Methylation in Case	7.50E-01 (Median)	Methylation in Control	7.01E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO2A1 in colon adenocarcinoma			[ 6 ]
Location	Body (cg14122373)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 3.27E-03; Z-score: 1.07E+00
Methylation in Case	6.26E-01 (Median)	Methylation in Control	5.51E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in colorectal cancer			[ 7 ]
Location	TSS1500 (cg05430989)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 1.84E-07; Z-score: 1.39E+00
Methylation in Case	3.53E-01 (Median)	Methylation in Control	2.80E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in colorectal cancer			[ 7 ]
Location	TSS1500 (cg07780818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 7.43E-05; Z-score: 6.22E-01
Methylation in Case	2.06E-01 (Median)	Methylation in Control	1.89E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO2A1 in colorectal cancer			[ 7 ]
Location	Body (cg17065011)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 9.09E-08; Z-score: -1.73E+00
Methylation in Case	6.98E-01 (Median)	Methylation in Control	7.59E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO2A1 in colorectal cancer			[ 7 ]
Location	Body (cg10577586)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.41E-07; Z-score: -2.75E+00
Methylation in Case	8.32E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO2A1 in colorectal cancer			[ 7 ]
Location	Body (cg16854533)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 3.67E-07; Z-score: -2.08E+00
Methylation in Case	8.30E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO2A1 in colorectal cancer			[ 7 ]
Location	Body (cg04900941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.42E-05; Z-score: -1.08E+00
Methylation in Case	8.43E-01 (Median)	Methylation in Control	8.67E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLCO2A1 in colorectal cancer			[ 7 ]
Location	Body (cg11282353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 1.17E-04; Z-score: -1.52E+00
Methylation in Case	2.55E-01 (Median)	Methylation in Control	3.55E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLCO2A1 in colorectal cancer			[ 7 ]
Location	Body (cg14955235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 4.27E-04; Z-score: -6.51E-01
Methylation in Case	8.09E-01 (Median)	Methylation in Control	8.37E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLCO2A1 in colorectal cancer			[ 7 ]
Location	Body (cg07562926)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.03E-03; Z-score: -7.09E-01
Methylation in Case	8.49E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLCO2A1 in colorectal cancer			[ 7 ]
Location	Body (cg25598319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.13E-03; Z-score: 3.91E-01
Methylation in Case	2.32E-01 (Median)	Methylation in Control	2.17E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLCO2A1 in colorectal cancer			[ 7 ]
Location	Body (cg22822824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 2.81E-02; Z-score: 4.40E-01
Methylation in Case	4.06E-02 (Median)	Methylation in Control	3.76E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
HIV infection	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in HIV infection			[ 8 ]
Location	TSS1500 (cg07780818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 5.61E-04; Z-score: 1.14E+00
Methylation in Case	1.75E-01 (Median)	Methylation in Control	1.36E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in HIV infection			[ 8 ]
Location	Body (cg17806191)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 1.92E-07; Z-score: 9.79E-01
Methylation in Case	9.33E-01 (Median)	Methylation in Control	9.13E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO2A1 in HIV infection			[ 8 ]
Location	Body (cg14955235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 6.37E-07; Z-score: -2.50E+00
Methylation in Case	6.86E-01 (Median)	Methylation in Control	7.73E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO2A1 in HIV infection			[ 8 ]
Location	Body (cg20388916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 1.20E-05; Z-score: -2.39E+00
Methylation in Case	7.07E-01 (Median)	Methylation in Control	8.12E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO2A1 in HIV infection			[ 8 ]
Location	Body (cg10577586)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 9.59E-04; Z-score: -1.34E+00
Methylation in Case	7.09E-01 (Median)	Methylation in Control	7.63E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO2A1 in HIV infection			[ 8 ]
Location	Body (cg02496728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.65E+00	Statistic Test	p-value: 2.45E-03; Z-score: 9.98E-01
Methylation in Case	5.43E-02 (Median)	Methylation in Control	3.29E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLCO2A1 in HIV infection			[ 8 ]
Location	Body (cg07708788)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 4.34E-03; Z-score: 8.70E-01
Methylation in Case	9.82E-02 (Median)	Methylation in Control	8.09E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLCO2A1 in HIV infection			[ 8 ]
Location	Body (cg07562926)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.55E-02; Z-score: -1.07E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	8.00E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLCO2A1 in HIV infection			[ 8 ]
Location	Body (cg17065011)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 2.24E-02; Z-score: 3.52E-01
Methylation in Case	6.21E-01 (Median)	Methylation in Control	6.08E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLCO2A1 in HIV infection			[ 8 ]
Location	Body (cg04900941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.08E-02; Z-score: 5.92E-01
Methylation in Case	6.98E-01 (Median)	Methylation in Control	6.63E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg05430989)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 3.22E-03; Z-score: 2.39E+00
Methylation in Case	3.26E-01 (Median)	Methylation in Control	2.59E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg07780818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.42E+00	Statistic Test	p-value: 8.05E-03; Z-score: 2.85E+00
Methylation in Case	2.14E-01 (Median)	Methylation in Control	1.51E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO2A1 in lung adenocarcinoma			[ 9 ]
Location	Body (cg20388916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 2.98E-03; Z-score: -2.39E+00
Methylation in Case	6.68E-01 (Median)	Methylation in Control	8.10E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO2A1 in lung adenocarcinoma			[ 9 ]
Location	Body (cg02496728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.58E+00	Statistic Test	p-value: 1.17E-02; Z-score: 4.81E+00
Methylation in Case	1.33E-01 (Median)	Methylation in Control	5.17E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO2A1 in lung adenocarcinoma			[ 9 ]
Location	Body (cg07708788)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.54E+00	Statistic Test	p-value: 1.66E-02; Z-score: 3.54E+00
Methylation in Case	1.57E-01 (Median)	Methylation in Control	1.02E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO2A1 in lung adenocarcinoma			[ 9 ]
Location	Body (cg14955235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.16E-02; Z-score: -2.16E+00
Methylation in Case	6.99E-01 (Median)	Methylation in Control	7.48E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLCO2A1 in lung adenocarcinoma			[ 9 ]
Location	Body (cg25598319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 3.17E-02; Z-score: 3.04E+00
Methylation in Case	2.17E-01 (Median)	Methylation in Control	1.67E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in papillary thyroid cancer			[ 10 ]
Location	TSS1500 (cg05430989)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 2.10E-03; Z-score: 6.90E-01
Methylation in Case	1.14E-01 (Median)	Methylation in Control	9.24E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in papillary thyroid cancer			[ 10 ]
Location	Body (cg16854533)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 2.21E-09; Z-score: -1.49E+00
Methylation in Case	5.99E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO2A1 in papillary thyroid cancer			[ 10 ]
Location	Body (cg17806191)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.65E-08; Z-score: 9.90E-01
Methylation in Case	7.40E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO2A1 in papillary thyroid cancer			[ 10 ]
Location	Body (cg14955235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 1.09E-04; Z-score: 1.40E+00
Methylation in Case	7.78E-01 (Median)	Methylation in Control	7.18E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO2A1 in papillary thyroid cancer			[ 10 ]
Location	Body (cg04900941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 4.00E-02; Z-score: 1.04E+00
Methylation in Case	8.58E-01 (Median)	Methylation in Control	8.24E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in prostate cancer			[ 11 ]
Location	TSS1500 (cg05483509)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.64E+00	Statistic Test	p-value: 2.62E-05; Z-score: 8.73E+00
Methylation in Case	4.68E-01 (Median)	Methylation in Control	1.77E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in prostate cancer			[ 11 ]
Location	TSS200 (cg15244223)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.47E+00	Statistic Test	p-value: 8.17E-03; Z-score: -2.22E+00
Methylation in Case	3.41E-02 (Median)	Methylation in Control	5.01E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO2A1 in prostate cancer			[ 11 ]
Location	Body (cg08789022)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.29E+00	Statistic Test	p-value: 1.16E-04; Z-score: 6.58E+00
Methylation in Case	5.46E-01 (Median)	Methylation in Control	1.66E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO2A1 in prostate cancer			[ 11 ]
Location	Body (cg04969220)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 1.78E-02; Z-score: -2.82E+00
Methylation in Case	5.20E-01 (Median)	Methylation in Control	7.30E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg02496728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.67E-04; Z-score: 7.60E-01
Methylation in Case	8.38E-01 (Median)	Methylation in Control	7.58E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg04900941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 9.84E-04; Z-score: 4.44E-01
Methylation in Case	1.81E-01 (Median)	Methylation in Control	1.50E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg07562926)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 4.36E-03; Z-score: 9.41E-01
Methylation in Case	8.10E-01 (Median)	Methylation in Control	7.30E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg07708788)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 4.91E-03; Z-score: 5.83E-01
Methylation in Case	1.67E-01 (Median)	Methylation in Control	1.35E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg10351795)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.43E-02; Z-score: 7.53E-01
Methylation in Case	8.75E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg10577586)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 1.55E-02; Z-score: 4.96E-01
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg11282353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 2.08E-02; Z-score: 6.41E-01
Methylation in Case	8.51E-01 (Median)	Methylation in Control	8.06E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in panic disorder			[ 13 ]
Location	Body (cg20388916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 4.95E-03; Z-score: 3.75E-01
Methylation in Case	2.39E+00 (Median)	Methylation in Control	2.23E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in panic disorder			[ 13 ]
Location	Body (cg17858406)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 3.80E-02; Z-score: 5.13E-01
Methylation in Case	3.12E+00 (Median)	Methylation in Control	3.01E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO2A1 in systemic lupus erythematosus			[ 14 ]
Location	Body (cg04900941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.22E-03; Z-score: 4.23E-01
Methylation in Case	7.36E-01 (Median)	Methylation in Control	7.12E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO2A1 in systemic lupus erythematosus			[ 14 ]
Location	Body (cg10351795)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 9.34E-03; Z-score: -2.38E-01
Methylation in Case	7.32E-01 (Median)	Methylation in Control	7.43E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO2A1 in systemic lupus erythematosus			[ 14 ]
Location	Body (cg17065011)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.04E-02; Z-score: -1.20E-01
Methylation in Case	6.56E-01 (Median)	Methylation in Control	6.61E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO2A1 in systemic lupus erythematosus			[ 14 ]
Location	Body (cg17806191)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.70E-02; Z-score: -8.64E-02
Methylation in Case	8.58E-01 (Median)	Methylation in Control	8.64E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLCO2A1 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.08E-39; Fold-change: 0.613891859; Z-score: 10.4118041
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Gastric cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLCO2A1 in gastric cancer than that in adjacent tissue
Studied Phenotype	Gastric cancer [ICD-11:2B72]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 1.44E-32; Fold-change: 0.204052614; Z-score: 32.9721226
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-181a directly targets SLCO2A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-181a	miRNA Mature ID	miR-181a-5p
miRNA Sequence	AACAUUCAACGCUGUCGGUGAGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)

References
1	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3	DNA Methylation Dynamics in Urological Tumors.
4	Genome-wide Scan for Methylation Profiles in Breast Cancer
5	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
7	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15	MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence