Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0502 Transporter Info
Gene Name SLCO4A1
Transporter Name Organic anion transporting polypeptide 4A1
Gene ID
28231
UniProt ID
Q96BD0
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

          14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg00152041)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 4.54E-09; Z-score: -1.48E+00

Methylation in Case

 8.58E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg01697623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 1.03E-08; Z-score: -1.46E+00

Methylation in Case

 7.23E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg04011829)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 2.27E-08; Z-score: 1.45E+00

Methylation in Case

 7.77E-01 (Median) Methylation in Control 6.48E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg05381729)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 4.66E-08; Z-score: -1.37E+00

Methylation in Case

 7.14E-01 (Median) Methylation in Control 7.99E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg06479426)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 6.02E-08; Z-score: -1.05E+00

Methylation in Case

 6.27E-01 (Median) Methylation in Control 7.07E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg12043732)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.45E+00 Statistic Test p-value: 3.45E-07; Z-score: -1.22E+00

Methylation in Case

 3.42E-01 (Median) Methylation in Control 4.95E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg26912312)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 1.39E-05; Z-score: -1.24E+00

Methylation in Case

 6.89E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg00465413)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 2.59E-05; Z-score: -8.54E-01

Methylation in Case

 7.68E-01 (Median) Methylation in Control 8.18E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg03151194)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 2.58E-04; Z-score: 1.08E+00

Methylation in Case

 5.23E-01 (Median) Methylation in Control 4.00E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg05134013)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.27E-03; Z-score: -7.13E-01

Methylation in Case

 7.77E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg09183468)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.63E+00 Statistic Test p-value: 9.54E-03; Z-score: 8.07E-01

Methylation in Case

 3.69E-01 (Median) Methylation in Control 2.26E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg10601171)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.65E-02; Z-score: -2.01E-01

Methylation in Case

 8.97E-01 (Median) Methylation in Control 9.08E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg13162609)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 3.32E-02; Z-score: 4.49E-01

Methylation in Case

 9.05E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 14

 Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg05327789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.75E+00 Statistic Test p-value: 3.65E-14; Z-score: 2.28E+00

Methylation in Case

 7.17E-01 (Median) Methylation in Control 4.09E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in bladder cancer [ 2 ]

Location

 5'UTR (cg05381729)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.89E+00 Statistic Test p-value: 1.78E-07; Z-score: -6.43E+00

Methylation in Case

 3.13E-01 (Median) Methylation in Control 5.92E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO4A1 in bladder cancer [ 2 ]

Location

 5'UTR (cg12043732)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.83E+00 Statistic Test p-value: 2.32E-06; Z-score: -6.73E+00

Methylation in Case

 2.72E-01 (Median) Methylation in Control 4.99E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO4A1 in bladder cancer [ 2 ]

Location

 5'UTR (cg04011829)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.42E+00 Statistic Test p-value: 1.26E-05; Z-score: -4.38E+00

Methylation in Case

 2.66E-01 (Median) Methylation in Control 3.76E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO4A1 in bladder cancer [ 2 ]

Location

 5'UTR (cg01697623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 1.61E-02; Z-score: -2.07E+00

Methylation in Case

 6.06E-01 (Median) Methylation in Control 6.89E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO4A1 in bladder cancer [ 2 ]

Location

 TSS1500 (cg09210315)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.54E+00 Statistic Test p-value: 3.18E-06; Z-score: -6.76E+00

Methylation in Case

 3.17E-01 (Median) Methylation in Control 4.88E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLCO4A1 in bladder cancer [ 2 ]

Location

 Body (cg00465413)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.61E+00 Statistic Test p-value: 5.63E-08; Z-score: -6.37E+00

Methylation in Case

 4.95E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLCO4A1 in bladder cancer [ 2 ]

Location

 Body (cg10601171)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 8.51E-08; Z-score: -6.08E+00

Methylation in Case

 5.27E-01 (Median) Methylation in Control 6.98E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLCO4A1 in bladder cancer [ 2 ]

Location

 Body (cg13162609)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.45E+00 Statistic Test p-value: 1.26E-07; Z-score: -1.63E+01

Methylation in Case

 5.73E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLCO4A1 in bladder cancer [ 2 ]

Location

 Body (cg16405768)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 8.88E-07; Z-score: -7.59E+00

Methylation in Case

 6.60E-01 (Median) Methylation in Control 7.72E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLCO4A1 in bladder cancer [ 2 ]

Location

 Body (cg21034324)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.58E+00 Statistic Test p-value: 9.78E-07; Z-score: -6.81E+00

Methylation in Case

 3.71E-01 (Median) Methylation in Control 5.88E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLCO4A1 in bladder cancer [ 2 ]

Location

 Body (cg09183468)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 3.18E-06; Z-score: -6.37E+00

Methylation in Case

 6.16E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLCO4A1 in bladder cancer [ 2 ]

Location

 Body (cg05134013)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 6.94E-05; Z-score: -2.91E+01

Methylation in Case

 8.96E-01 (Median) Methylation in Control 9.77E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLCO4A1 in bladder cancer [ 2 ]

Location

 3'UTR (cg05327789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.87E+00 Statistic Test p-value: 2.15E-06; Z-score: -5.08E+00

Methylation in Case

 4.29E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

          14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 5'UTR (cg04011829)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 2.51E-14; Z-score: 2.83E+00

Methylation in Case

 4.55E-01 (Median) Methylation in Control 3.43E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 5'UTR (cg00152041)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.58E+00 Statistic Test p-value: 6.09E-13; Z-score: 2.72E+00

Methylation in Case

 1.77E-01 (Median) Methylation in Control 1.11E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 5'UTR (cg05381729)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 5.04E-06; Z-score: -1.35E+00

Methylation in Case

 5.44E-01 (Median) Methylation in Control 6.25E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 TSS1500 (cg16180531)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.68E+00 Statistic Test p-value: 4.35E-09; Z-score: -1.42E+00

Methylation in Case

 1.10E-01 (Median) Methylation in Control 1.84E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 TSS1500 (cg22744368)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.56E+00 Statistic Test p-value: 1.28E-04; Z-score: -8.78E-01

Methylation in Case

 5.17E-02 (Median) Methylation in Control 8.05E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 TSS1500 (cg09210315)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 5.08E-04; Z-score: -1.44E+00

Methylation in Case

 3.83E-01 (Median) Methylation in Control 4.60E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 Body (cg00465413)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.54E-09; Z-score: -2.01E+00

Methylation in Case

 7.34E-01 (Median) Methylation in Control 7.99E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 Body (cg13162609)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 9.33E-09; Z-score: -2.00E+00

Methylation in Case

 7.79E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 Body (cg10601171)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.43E-08; Z-score: -1.46E+00

Methylation in Case

 6.82E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 Body (cg16405768)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.80E-08; Z-score: -1.45E+00

Methylation in Case

 7.47E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 Body (cg09183468)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 5.40E-07; Z-score: -1.13E+00

Methylation in Case

 7.17E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 Body (cg05134013)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.37E-05; Z-score: -5.65E-01

Methylation in Case

 9.68E-01 (Median) Methylation in Control 9.78E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 Body (cg21034324)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 1.60E-05; Z-score: -1.03E+00

Methylation in Case

 5.86E-01 (Median) Methylation in Control 6.62E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 14

 Methylation of SLCO4A1 in breast cancer [ 3 ]

Location

 3'UTR (cg05327789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 5.94E-09; Z-score: -1.28E+00

Methylation in Case

 7.02E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg00152041)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.71E+00 Statistic Test p-value: 4.90E-04; Z-score: -1.68E+00

Methylation in Case

 9.47E-02 (Median) Methylation in Control 1.62E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO4A1 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg09210315)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.63E+00 Statistic Test p-value: 7.07E-17; Z-score: -5.04E+00

Methylation in Case

 4.20E-01 (Median) Methylation in Control 6.85E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO4A1 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg16180531)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.71E+00 Statistic Test p-value: 1.88E-05; Z-score: -1.12E+00

Methylation in Case

 4.24E-02 (Median) Methylation in Control 7.26E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO4A1 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg10601171)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 8.74E-05; Z-score: -1.70E+00

Methylation in Case

 8.42E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO4A1 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg09183468)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 5.99E-04; Z-score: -1.38E+00

Methylation in Case

 8.60E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLCO4A1 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg16405768)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 7.77E-04; Z-score: -1.84E+00

Methylation in Case

 8.90E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLCO4A1 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg00465413)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.01E-02; Z-score: -5.09E-01

Methylation in Case

 9.05E-01 (Median) Methylation in Control 9.12E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLCO4A1 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg13162609)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.49E-02; Z-score: -8.16E-01

Methylation in Case

 9.26E-01 (Median) Methylation in Control 9.36E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in colorectal cancer [ 5 ]

Location

 5'UTR (cg01697623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.21E-02; Z-score: -4.62E-01

Methylation in Case

 8.63E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO4A1 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg16180531)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 2.39E-03; Z-score: 5.89E-01

Methylation in Case

 1.29E-01 (Median) Methylation in Control 1.13E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO4A1 in colorectal cancer [ 5 ]

Location

 Body (cg09183468)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.43E-10; Z-score: -2.91E+00

Methylation in Case

 8.35E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO4A1 in colorectal cancer [ 5 ]

Location

 Body (cg16405768)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.43E-08; Z-score: -2.32E+00

Methylation in Case

 8.93E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO4A1 in colorectal cancer [ 5 ]

Location

 Body (cg00465413)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 6.13E-06; Z-score: -2.06E+00

Methylation in Case

 9.10E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLCO4A1 in colorectal cancer [ 5 ]

Location

 Body (cg10601171)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 7.53E-05; Z-score: -1.02E+00

Methylation in Case

 8.19E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLCO4A1 in colorectal cancer [ 5 ]

Location

 Body (cg13162609)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.04E-04; Z-score: -2.15E+00

Methylation in Case

 9.24E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLCO4A1 in colorectal cancer [ 5 ]

Location

 Body (cg21034324)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 8.36E-03; Z-score: -9.13E-01

Methylation in Case

 6.43E-01 (Median) Methylation in Control 7.48E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLCO4A1 in colorectal cancer [ 5 ]

Location

 3'UTR (cg05327789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 6.89E-10; Z-score: -2.37E+00

Methylation in Case

 7.28E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg04011829)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 6.65E-05; Z-score: -2.28E+00

Methylation in Case

 4.14E-01 (Median) Methylation in Control 5.07E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO4A1 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg06479426)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 7.47E-05; Z-score: 1.20E+00

Methylation in Case

 8.60E-02 (Median) Methylation in Control 6.65E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO4A1 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg26912312)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 9.50E-05; Z-score: 1.23E+00

Methylation in Case

 9.02E-02 (Median) Methylation in Control 7.46E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO4A1 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg05118482)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.85E+00 Statistic Test p-value: 3.56E-13; Z-score: 6.14E+00

Methylation in Case

 3.83E-01 (Median) Methylation in Control 1.35E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO4A1 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg09210315)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.66E+00 Statistic Test p-value: 1.20E-08; Z-score: -3.13E+00

Methylation in Case

 2.61E-01 (Median) Methylation in Control 4.33E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLCO4A1 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg22744368)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 1.30E-02; Z-score: 3.09E-01

Methylation in Case

 5.28E-02 (Median) Methylation in Control 4.62E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLCO4A1 in hepatocellular carcinoma [ 6 ]

Location

 TSS200 (cg14796370)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.72E+00 Statistic Test p-value: 6.37E-06; Z-score: 1.57E+00

Methylation in Case

 4.10E-02 (Median) Methylation in Control 2.38E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLCO4A1 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg26065534)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.49E+00 Statistic Test p-value: 3.17E-17; Z-score: -3.61E+00

Methylation in Case

 5.30E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLCO4A1 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg18145189)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 6.45E-11; Z-score: -6.18E+00

Methylation in Case

 7.27E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLCO4A1 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg00966749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 1.87E-10; Z-score: -8.61E+00

Methylation in Case

 6.50E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLCO4A1 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg05134013)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.24E-08; Z-score: -4.48E+00

Methylation in Case

 9.32E-01 (Median) Methylation in Control 9.79E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLCO4A1 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg13162609)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.11E-05; Z-score: -1.01E+00

Methylation in Case

 8.09E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in HIV infection [ 7 ]

Location

 5'UTR (cg05381729)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 8.39E-06; Z-score: -1.07E+00

Methylation in Case

 6.87E-01 (Median) Methylation in Control 7.25E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO4A1 in HIV infection [ 7 ]

Location

 5'UTR (cg00152041)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.23E-02; Z-score: 6.03E-01

Methylation in Case

 2.03E-01 (Median) Methylation in Control 1.80E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO4A1 in HIV infection [ 7 ]

Location

 5'UTR (cg26912312)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.24E-02; Z-score: 3.41E-01

Methylation in Case

 7.15E-02 (Median) Methylation in Control 6.71E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO4A1 in HIV infection [ 7 ]

Location

 TSS1500 (cg09210315)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 2.94E-05; Z-score: 1.62E+00

Methylation in Case

 3.02E-01 (Median) Methylation in Control 2.36E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO4A1 in HIV infection [ 7 ]

Location

 Body (cg09183468)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 2.24E-05; Z-score: 6.74E-01

Methylation in Case

 8.55E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLCO4A1 in HIV infection [ 7 ]

Location

 Body (cg10601171)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.26E-03; Z-score: -1.05E+00

Methylation in Case

 7.49E-01 (Median) Methylation in Control 7.81E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLCO4A1 in HIV infection [ 7 ]

Location

 Body (cg00465413)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.83E-02; Z-score: 4.22E-01

Methylation in Case

 8.69E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLCO4A1 in HIV infection [ 7 ]

Location

 Body (cg21034324)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.84E-02; Z-score: -4.78E-01

Methylation in Case

 7.74E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLCO4A1 in HIV infection [ 7 ]

Location

 3'UTR (cg05327789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.76E+00 Statistic Test p-value: 1.10E-10; Z-score: 3.33E+00

Methylation in Case

 6.99E-01 (Median) Methylation in Control 3.98E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in lung adenocarcinoma [ 8 ]

Location

 5'UTR (cg01697623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 5.55E-04; Z-score: 1.72E+00

Methylation in Case

 8.26E-01 (Median) Methylation in Control 7.67E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO4A1 in lung adenocarcinoma [ 8 ]

Location

 5'UTR (cg12043732)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 5.67E-03; Z-score: 4.35E+00

Methylation in Case

 6.91E-01 (Median) Methylation in Control 5.53E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO4A1 in lung adenocarcinoma [ 8 ]

Location

 5'UTR (cg05381729)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 3.55E-02; Z-score: -1.07E+00

Methylation in Case

 6.34E-01 (Median) Methylation in Control 7.05E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO4A1 in lung adenocarcinoma [ 8 ]

Location

 TSS1500 (cg09210315)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 1.91E-02; Z-score: -1.53E+00

Methylation in Case

 4.59E-01 (Median) Methylation in Control 5.74E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO4A1 in lung adenocarcinoma [ 8 ]

Location

 3'UTR (cg05327789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.93E-02; Z-score: -1.15E+00

Methylation in Case

 7.39E-01 (Median) Methylation in Control 7.69E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in pancretic ductal adenocarcinoma [ 9 ]

Location

 5'UTR (cg16897885)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 2.93E-10; Z-score: 9.23E-01

Methylation in Case

 6.05E-02 (Median) Methylation in Control 5.21E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO4A1 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg02505749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.99E+00 Statistic Test p-value: 1.89E-15; Z-score: 3.19E+00

Methylation in Case

 5.25E-01 (Median) Methylation in Control 1.76E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO4A1 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg21442626)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 5.51E-09; Z-score: -1.73E+00

Methylation in Case

 3.64E-01 (Median) Methylation in Control 4.75E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO4A1 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg22764341)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 3.92E-02; Z-score: 5.86E-01

Methylation in Case

 1.07E-01 (Median) Methylation in Control 8.72E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO4A1 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS200 (cg10068408)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.08E-06; Z-score: -1.01E+00

Methylation in Case

 6.36E-01 (Median) Methylation in Control 6.73E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLCO4A1 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS200 (cg25580254)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.74E+00 Statistic Test p-value: 1.70E-05; Z-score: -8.77E-01

Methylation in Case

 8.78E-02 (Median) Methylation in Control 1.52E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLCO4A1 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg17958577)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 9.59E-09; Z-score: 1.47E+00

Methylation in Case

 7.73E-01 (Median) Methylation in Control 7.06E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in papillary thyroid cancer [ 10 ]

Location

 5'UTR (cg04011829)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 1.84E-06; Z-score: 1.40E+00

Methylation in Case

 4.75E-01 (Median) Methylation in Control 3.71E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO4A1 in papillary thyroid cancer [ 10 ]

Location

 5'UTR (cg05381729)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 5.20E-03; Z-score: -3.53E-01

Methylation in Case

 7.65E-01 (Median) Methylation in Control 7.81E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO4A1 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg09210315)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 1.73E-07; Z-score: -1.19E+00

Methylation in Case

 5.64E-01 (Median) Methylation in Control 6.43E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO4A1 in papillary thyroid cancer [ 10 ]

Location

 Body (cg09183468)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 4.34E-03; Z-score: 4.61E-01

Methylation in Case

 8.41E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO4A1 in papillary thyroid cancer [ 10 ]

Location

 3'UTR (cg05327789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.52E-02; Z-score: -8.83E-01

Methylation in Case

 8.00E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in systemic lupus erythematosus [ 11 ]

Location

 5'UTR (cg04011829)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.03E-03; Z-score: -2.83E-01

Methylation in Case

 8.56E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO4A1 in systemic lupus erythematosus [ 11 ]

Location

 5'UTR (cg00152041)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 6.86E-03; Z-score: -1.67E-01

Methylation in Case

 2.95E-01 (Median) Methylation in Control 3.04E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO4A1 in systemic lupus erythematosus [ 11 ]

Location

 5'UTR (cg26912312)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 9.74E-03; Z-score: -2.23E-01

Methylation in Case

 8.84E-02 (Median) Methylation in Control 9.18E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO4A1 in systemic lupus erythematosus [ 11 ]

Location

 Body (cg21034324)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.99E-03; Z-score: -2.59E-01

Methylation in Case

 7.81E-01 (Median) Methylation in Control 8.01E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Celiac disease

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in celiac disease [ 12 ]

Location

 TSS1500 (cg16180531)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.69E+00 Statistic Test p-value: 3.83E-02; Z-score: 1.47E+00

Methylation in Case

 6.10E-02 (Median) Methylation in Control 3.60E-02 (Median)

Studied Phenotype

 Celiac disease [ ICD-11: DA95]

Experimental Material

 Patient tissue samples

  Colon cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in colon adenocarcinoma [ 13 ]

Location

 TSS1500 (cg18624900)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.08E+00 Statistic Test p-value: 1.67E-10; Z-score: 3.85E+00

Methylation in Case

 5.30E-01 (Median) Methylation in Control 2.55E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO4A1 in colon adenocarcinoma [ 13 ]

Location

 TSS1500 (cg14161359)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.34E+00 Statistic Test p-value: 2.94E-05; Z-score: 1.93E+00

Methylation in Case

 5.02E-01 (Median) Methylation in Control 3.74E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO4A1 in colon adenocarcinoma [ 13 ]

Location

 TSS1500 (cg03699904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 1.15E-04; Z-score: -2.46E+00

Methylation in Case

 2.69E-01 (Median) Methylation in Control 3.59E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO4A1 in colon adenocarcinoma [ 13 ]

Location

 TSS1500 (cg13800769)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 1.54E-04; Z-score: -1.39E+00

Methylation in Case

 3.97E-01 (Median) Methylation in Control 5.10E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO4A1 in colon adenocarcinoma [ 13 ]

Location

 TSS1500 (cg07827943)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.47E+00 Statistic Test p-value: 2.93E-03; Z-score: 4.65E+00

Methylation in Case

 2.99E-01 (Median) Methylation in Control 2.04E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLCO4A1 in colon adenocarcinoma [ 13 ]

Location

 TSS200 (cg18158438)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 1.33E-04; Z-score: -7.63E-01

Methylation in Case

 2.62E-01 (Median) Methylation in Control 3.23E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLCO4A1 in colon adenocarcinoma [ 13 ]

Location

 Body (cg23368787)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 1.18E-05; Z-score: 1.51E+00

Methylation in Case

 6.20E-01 (Median) Methylation in Control 5.70E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Prostate cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in prostate cancer [ 14 ]

Location

 TSS1500 (cg24325996)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 1.29E-03; Z-score: 4.09E+00

Methylation in Case

 6.76E-01 (Median) Methylation in Control 5.40E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO4A1 in prostate cancer [ 14 ]

Location

 TSS1500 (cg05331214)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.78E+00 Statistic Test p-value: 4.00E-02; Z-score: -9.33E+00

Methylation in Case

 4.40E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLCO4A1 in prostate cancer [ 14 ]

Location

 TSS1500 (cg15490596)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 4.15E-02; Z-score: 3.59E+00

Methylation in Case

 8.88E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLCO4A1 in prostate cancer [ 14 ]

Location

 1stExon (cg14736210)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.31E-02; Z-score: 2.65E+00

Methylation in Case

 9.31E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLCO4A1 in prostate cancer [ 14 ]

Location

 Body (cg12204395)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 9.51E-03; Z-score: 2.45E+00

Methylation in Case

 9.46E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLCO4A1 in prostate cancer [ 14 ]

Location

 Body (cg02557110)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 3.12E-02; Z-score: 2.94E+00

Methylation in Case

 8.69E-01 (Median) Methylation in Control 7.91E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLCO4A1 in prostate cancer [ 14 ]

Location

 Body (cg10872847)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 3.67E-02; Z-score: 2.57E+00

Methylation in Case

 9.32E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLCO4A1 in prostate cancer [ 14 ]

Location

 Body (cg16738646)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 3.79E-02; Z-score: -1.82E+00

Methylation in Case

 3.43E-01 (Median) Methylation in Control 4.61E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLCO4A1 in prostate cancer [ 14 ]

Location

 3'UTR (cg19086001)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 4.28E-02; Z-score: 1.73E+00

Methylation in Case

 8.74E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO4A1 in panic disorder [ 15 ]

Location

 TSS200 (cg25222263)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 9.78E-01 Statistic Test p-value: 6.04E-03; Z-score: 6.64E-01

Methylation in Case

 -5.86E+00 (Median) Methylation in Control -5.99E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7e directly targets SLCO4A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 let-7e miRNA Mature ID let-7e-5p

miRNA Sequence

 UGAGGUAGGAGGUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-335 directly targets SLCO4A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-92b directly targets SLCO4A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-92b miRNA Mature ID miR-92b-3p

miRNA Sequence

 UAUUGCACUCGUCCCGGCCUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
13 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
14 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
16 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
17 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.