Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0503 Transporter Info
Gene Name	SLCO4C1
Transporter Name	Organic anion transporting polypeptide 4C1
Gene ID	353189
UniProt ID	Q6ZQN7

Epigenetic Regulations of This DT (EGR)
Methylation
Pancretic ductal adenocarcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg03721454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 6.36E-03; Z-score: 4.25E-01
Methylation in Case	7.18E-01 (Median)	Methylation in Control	6.91E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO4C1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg14482308)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.54E+00	Statistic Test	p-value: 2.66E-14; Z-score: 2.24E+00
Methylation in Case	4.32E-01 (Median)	Methylation in Control	2.80E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO4C1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg26360695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 3.39E-03; Z-score: -8.12E-01
Methylation in Case	1.16E-01 (Median)	Methylation in Control	1.39E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO4C1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg23375719)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 6.26E-03; Z-score: -4.47E-01
Methylation in Case	1.17E-01 (Median)	Methylation in Control	1.39E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO4C1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg17221813)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 3.56E-04; Z-score: 8.90E-01
Methylation in Case	7.88E-01 (Median)	Methylation in Control	7.29E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO4C1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg10117207)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 1.17E-03; Z-score: 1.09E+00
Methylation in Case	8.56E-01 (Median)	Methylation in Control	7.28E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLCO4C1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg04070804)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 4.54E-03; Z-score: 9.05E-01
Methylation in Case	8.74E-01 (Median)	Methylation in Control	8.44E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLCO4C1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg18312989)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.27E-02; Z-score: -6.01E-01
Methylation in Case	5.07E-01 (Median)	Methylation in Control	5.45E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLCO4C1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	3'UTR (cg14022794)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 9.93E-04; Z-score: -9.85E-01
Methylation in Case	3.45E-01 (Median)	Methylation in Control	3.80E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in bladder cancer			[ 2 ]
Location	TSS1500 (cg12864568)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.36E+00	Statistic Test	p-value: 2.76E-06; Z-score: -5.46E+00
Methylation in Case	1.13E-01 (Median)	Methylation in Control	2.67E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO4C1 in bladder cancer			[ 2 ]
Location	TSS1500 (cg24036612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 2.72E-03; Z-score: -4.69E+00
Methylation in Case	8.20E-01 (Median)	Methylation in Control	8.65E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO4C1 in bladder cancer			[ 2 ]
Location	TSS1500 (cg19774478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.86E+00	Statistic Test	p-value: 1.24E-02; Z-score: -2.34E+00
Methylation in Case	7.08E-02 (Median)	Methylation in Control	1.32E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in breast cancer			[ 3 ]
Location	TSS1500 (cg19774478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.83E-03; Z-score: -2.13E-02
Methylation in Case	7.56E-02 (Median)	Methylation in Control	7.62E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO4C1 in breast cancer			[ 3 ]
Location	TSS1500 (cg24036612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.08E-02; Z-score: -7.04E-01
Methylation in Case	8.44E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO4C1 in breast cancer			[ 3 ]
Location	TSS200 (cg19788741)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 5.54E-03; Z-score: -1.40E-01
Methylation in Case	3.24E-02 (Median)	Methylation in Control	3.53E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO4C1 in breast cancer			[ 3 ]
Location	TSS200 (cg11267955)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 6.44E-03; Z-score: -4.26E-01
Methylation in Case	5.47E-02 (Median)	Methylation in Control	6.15E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO4C1 in breast cancer			[ 3 ]
Location	TSS200 (cg04633600)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.58E-02; Z-score: 3.03E-01
Methylation in Case	4.91E-02 (Median)	Methylation in Control	4.41E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO4C1 in breast cancer			[ 3 ]
Location	TSS200 (cg04621020)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 2.01E-02; Z-score: -4.02E-01
Methylation in Case	5.96E-02 (Median)	Methylation in Control	6.52E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLCO4C1 in breast cancer			[ 3 ]
Location	TSS200 (cg06480736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 2.01E-02; Z-score: -2.38E-01
Methylation in Case	6.40E-02 (Median)	Methylation in Control	6.79E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLCO4C1 in breast cancer			[ 3 ]
Location	Body (cg23318786)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 1.39E-02; Z-score: 2.18E-01
Methylation in Case	2.73E-02 (Median)	Methylation in Control	2.49E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLCO4C1 in breast cancer			[ 3 ]
Location	3'UTR (cg00630480)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 7.63E-07; Z-score: 9.00E-01
Methylation in Case	6.03E-01 (Median)	Methylation in Control	5.52E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg12864568)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.66E+00	Statistic Test	p-value: 3.80E-02; Z-score: -1.81E+00
Methylation in Case	1.15E-01 (Median)	Methylation in Control	1.91E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO4C1 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg22149516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.46E+00	Statistic Test	p-value: 1.17E-02; Z-score: -1.17E+00
Methylation in Case	6.30E-02 (Median)	Methylation in Control	9.18E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO4C1 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg23318786)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 1.17E-03; Z-score: 3.23E-01
Methylation in Case	1.82E-02 (Median)	Methylation in Control	1.74E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in colon adenocarcinoma			[ 5 ]
Location	TSS1500 (cg03586474)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.77E+00	Statistic Test	p-value: 1.80E-03; Z-score: 3.56E+00
Methylation in Case	2.33E-01 (Median)	Methylation in Control	1.32E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO4C1 in colon adenocarcinoma			[ 5 ]
Location	Body (cg03366891)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 2.16E-04; Z-score: -3.03E+00
Methylation in Case	7.22E-01 (Median)	Methylation in Control	7.96E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg19774478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 3.68E-05; Z-score: 1.02E+00
Methylation in Case	2.53E-01 (Median)	Methylation in Control	1.91E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO4C1 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg12864568)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.56E+00	Statistic Test	p-value: 1.26E-04; Z-score: 1.62E+00
Methylation in Case	4.54E-01 (Median)	Methylation in Control	2.91E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO4C1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg04621020)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 5.44E+00	Statistic Test	p-value: 4.80E-13; Z-score: 6.66E+00
Methylation in Case	5.50E-01 (Median)	Methylation in Control	1.01E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO4C1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg06480736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 6.46E+00	Statistic Test	p-value: 2.11E-12; Z-score: 7.33E+00
Methylation in Case	3.71E-01 (Median)	Methylation in Control	5.74E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO4C1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg11267955)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 8.40E+00	Statistic Test	p-value: 3.88E-12; Z-score: 7.65E+00
Methylation in Case	4.00E-01 (Median)	Methylation in Control	4.76E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO4C1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg19788741)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+01	Statistic Test	p-value: 4.49E-12; Z-score: 6.05E+00
Methylation in Case	4.42E-01 (Median)	Methylation in Control	3.73E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLCO4C1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg22149516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.42E+00	Statistic Test	p-value: 4.74E-12; Z-score: 4.35E+00
Methylation in Case	5.86E-01 (Median)	Methylation in Control	1.71E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLCO4C1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg11009817)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.59E+00	Statistic Test	p-value: 1.05E-11; Z-score: 5.09E+00
Methylation in Case	4.04E-01 (Median)	Methylation in Control	1.12E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLCO4C1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg04633600)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.17E+00	Statistic Test	p-value: 2.90E-10; Z-score: 6.04E+00
Methylation in Case	2.08E-01 (Median)	Methylation in Control	5.00E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLCO4C1 in colorectal cancer			[ 6 ]
Location	1stExon (cg00056676)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 2.86E-08; Z-score: 2.44E+00
Methylation in Case	1.69E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLCO4C1 in colorectal cancer			[ 6 ]
Location	Body (cg23318786)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.37E+00	Statistic Test	p-value: 1.46E-08; Z-score: 5.96E+00
Methylation in Case	4.58E-02 (Median)	Methylation in Control	1.93E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLCO4C1 in colorectal cancer			[ 6 ]
Location	3'UTR (cg00630480)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 8.49E-05; Z-score: -1.23E+00
Methylation in Case	7.04E-01 (Median)	Methylation in Control	7.47E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg19774478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 6.88E-06; Z-score: 1.35E+00
Methylation in Case	1.32E-01 (Median)	Methylation in Control	9.96E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO4C1 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg24036612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 4.53E-05; Z-score: -6.01E-01
Methylation in Case	7.70E-01 (Median)	Methylation in Control	8.03E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO4C1 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg11267955)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.01E+00	Statistic Test	p-value: 3.07E-09; Z-score: 4.29E+00
Methylation in Case	1.58E-01 (Median)	Methylation in Control	5.25E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO4C1 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg04621020)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.43E+00	Statistic Test	p-value: 5.14E-09; Z-score: 5.54E+00
Methylation in Case	1.60E-01 (Median)	Methylation in Control	6.57E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO4C1 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg06480736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.91E+00	Statistic Test	p-value: 6.97E-09; Z-score: 2.44E+00
Methylation in Case	1.33E-01 (Median)	Methylation in Control	6.97E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO4C1 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg11009817)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.64E+00	Statistic Test	p-value: 2.20E-07; Z-score: 3.38E+00
Methylation in Case	1.03E-01 (Median)	Methylation in Control	6.31E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLCO4C1 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg04633600)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 2.35E-06; Z-score: 6.92E-01
Methylation in Case	6.60E-02 (Median)	Methylation in Control	5.24E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLCO4C1 in hepatocellular carcinoma			[ 7 ]
Location	1stExon (cg00056676)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.74E-02; Z-score: 1.70E-01
Methylation in Case	8.40E-02 (Median)	Methylation in Control	8.17E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLCO4C1 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg09647867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 3.68E-15; Z-score: -4.63E+00
Methylation in Case	4.92E-01 (Median)	Methylation in Control	6.69E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in HIV infection			[ 8 ]
Location	TSS1500 (cg19774478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 4.15E-03; Z-score: 6.51E-01
Methylation in Case	5.83E-02 (Median)	Methylation in Control	4.95E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO4C1 in HIV infection			[ 8 ]
Location	TSS1500 (cg12864568)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 1.88E-02; Z-score: 1.07E+00
Methylation in Case	8.71E-02 (Median)	Methylation in Control	6.59E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO4C1 in HIV infection			[ 8 ]
Location	TSS200 (cg19788741)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 4.15E-03; Z-score: 1.06E+00
Methylation in Case	2.92E-02 (Median)	Methylation in Control	2.20E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLCO4C1 in HIV infection			[ 8 ]
Location	TSS200 (cg11009817)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 2.66E-02; Z-score: 3.03E-01
Methylation in Case	4.28E-02 (Median)	Methylation in Control	4.00E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLCO4C1 in HIV infection			[ 8 ]
Location	TSS200 (cg06480736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 4.39E-02; Z-score: 4.27E-01
Methylation in Case	5.19E-02 (Median)	Methylation in Control	4.64E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLCO4C1 in HIV infection			[ 8 ]
Location	TSS200 (cg04633600)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 4.62E-02; Z-score: 5.51E-01
Methylation in Case	8.50E-02 (Median)	Methylation in Control	7.62E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLCO4C1 in HIV infection			[ 8 ]
Location	Body (cg23318786)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 2.49E-03; Z-score: 6.90E-01
Methylation in Case	1.99E-02 (Median)	Methylation in Control	1.42E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg24036612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.27E-04; Z-score: -7.93E-01
Methylation in Case	8.59E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO4C1 in papillary thyroid cancer			[ 9 ]
Location	TSS200 (cg11009817)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 4.73E-02; Z-score: -1.03E+00
Methylation in Case	6.82E-02 (Median)	Methylation in Control	8.58E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO4C1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg23318786)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 8.47E-03; Z-score: 2.63E-01
Methylation in Case	5.49E-02 (Median)	Methylation in Control	5.30E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in prostate cancer			[ 10 ]
Location	TSS1500 (cg27365825)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.05E+00	Statistic Test	p-value: 3.12E-04; Z-score: 1.13E+01
Methylation in Case	6.29E-01 (Median)	Methylation in Control	2.06E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Moderate hypermethylation of SLCO4C1 in prostate cancer than that in healthy individual
Studied Phenotype	Prostate cancer [ICD-11:2C82]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.84E-29; Fold-change: 0.221026205; Z-score: 10.80695502
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lung adenocarcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg11009817)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 1.02E-02; Z-score: -1.76E+00
Methylation in Case	9.22E-02 (Median)	Methylation in Control	1.18E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in systemic lupus erythematosus			[ 12 ]
Location	TSS200 (cg19788741)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.82E-03; Z-score: 1.68E-01
Methylation in Case	2.67E-02 (Median)	Methylation in Control	2.54E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO4C1 in systemic lupus erythematosus			[ 12 ]
Location	TSS200 (cg06480736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 5.84E-03; Z-score: 1.68E-01
Methylation in Case	5.73E-02 (Median)	Methylation in Control	5.52E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLCO4C1 in systemic lupus erythematosus			[ 12 ]
Location	3'UTR (cg00630480)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 2.28E-02; Z-score: -5.57E-02
Methylation in Case	8.32E-01 (Median)	Methylation in Control	8.35E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	1stExon (cg00056676)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.70E+00	Statistic Test	p-value: 3.86E-42; Z-score: -6.50E+00
Methylation in Case	2.99E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO4C1 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	3'UTR (cg00630480)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.15E-15; Z-score: -2.99E+00
Methylation in Case	7.78E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLCO4C1 in panic disorder			[ 14 ]
Location	Body (cg23318786)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.92E-01	Statistic Test	p-value: 2.58E-02; Z-score: -2.31E-01
Methylation in Case	-5.48E+00 (Median)	Methylation in Control	-5.43E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLCO4C1 in panic disorder			[ 14 ]
Location	3'UTR (cg00630480)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.68E+00	Statistic Test	p-value: 2.54E-06; Z-score: -8.11E-01
Methylation in Case	5.29E-01 (Median)	Methylation in Control	8.88E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Glioblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLCO4C1 in glioblastoma than that in healthy individual
Studied Phenotype	Glioblastoma [ICD-11:2A00.00]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.03E-09; Fold-change: 0.481928989; Z-score: 2.094793725
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLCO4C1 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 4.10E-12; Fold-change: 0.469252292; Z-score: 2.714278546
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Malignant astrocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLCO4C1 in malignant astrocytoma than that in healthy individual
Studied Phenotype	Malignant astrocytoma [ICD-11:2A00.12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.53E-64; Fold-change: 0.448187519; Z-score: 3.221077222
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLCO4C1 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 4.00E-31; Fold-change: 0.725989969; Z-score: 4.631156229
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLCO4C1 in oligodendroglial tumour than that in healthy individual
Studied Phenotype	Oligodendroglial tumour [ICD-11:2A00.Y1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.04E-08; Fold-change: 0.333051983; Z-score: 6.95185281
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLCO4C1 in oligodendroglioma than that in healthy individual
Studied Phenotype	Oligodendroglioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 6.00E-25; Fold-change: 0.402987977; Z-score: 2.33098834
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Prostate cancer metastasis	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLCO4C1 in prostate cancer metastasis than that in healthy individual
Studied Phenotype	Prostate cancer metastasis [ICD-11:2.00E+06]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.28E-06; Fold-change: 0.577116201; Z-score: 22.24530136
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	25 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-518f directly targets SLCO4C1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
Related Molecular Changes	Down regulation of SLCO4C1	Experiment Method	qRT-PCR
miRNA Stemloop ID	miR-518f	miRNA Mature ID	miR-518f-3p
miRNA Sequence	GAAAGCGCUUCUCUUUAGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Additional Notes	SLCO4C1 the predicted target of miR 518f-3p was determined in cell lysates of PBMCs infected with HIV-1 or HIV-2.
Epigenetic Phenomenon 2	miR-1185 directly targets SLCO4C1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1185	miRNA Mature ID	miR-1185-5p
miRNA Sequence	AGAGGAUACCCUUUGUAUGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-1224 directly targets SLCO4C1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1224	miRNA Mature ID	miR-1224-5p
miRNA Sequence	GUGAGGACUCGGGAGGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-124 directly targets SLCO4C1			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-124	miRNA Mature ID	miR-124-5p
miRNA Sequence	CGUGUUCACAGCGGACCUUGAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 5	miR-1264 directly targets SLCO4C1			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1264	miRNA Mature ID	miR-1264
miRNA Sequence	CAAGUCUUAUUUGAGCACCUGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-148b directly targets SLCO4C1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-148b	miRNA Mature ID	miR-148b-3p
miRNA Sequence	UCAGUGCAUCACAGAACUUUGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 7	miR-2115 directly targets SLCO4C1			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-2115	miRNA Mature ID	miR-2115-5p
miRNA Sequence	AGCUUCCAUGACUCCUGAUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-335 directly targets SLCO4C1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-3605 directly targets SLCO4C1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3605	miRNA Mature ID	miR-3605-5p
miRNA Sequence	UGAGGAUGGAUAGCAAGGAAGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-3679 directly targets SLCO4C1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3679	miRNA Mature ID	miR-3679-5p
miRNA Sequence	UGAGGAUAUGGCAGGGAAGGGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-3692 directly targets SLCO4C1			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3692	miRNA Mature ID	miR-3692-3p
miRNA Sequence	GUUCCACACUGACACUGCAGAAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-3915 directly targets SLCO4C1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3915	miRNA Mature ID	miR-3915
miRNA Sequence	UUGAGGAAAAGAUGGUCUUAUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-3938 directly targets SLCO4C1			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3938	miRNA Mature ID	miR-3938
miRNA Sequence	AAUUCCCUUGUAGAUAACCCGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-4455 directly targets SLCO4C1			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4455	miRNA Mature ID	miR-4455
miRNA Sequence	AGGGUGUGUGUGUUUUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 15	miR-4689 directly targets SLCO4C1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4689	miRNA Mature ID	miR-4689
miRNA Sequence	UUGAGGAGACAUGGUGGGGGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-516a directly targets SLCO4C1			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-516a	miRNA Mature ID	miR-516a-3p
miRNA Sequence	UGCUUCCUUUCAGAGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-516b directly targets SLCO4C1			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-516b	miRNA Mature ID	miR-516b-3p
miRNA Sequence	UGCUUCCUUUCAGAGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-574 directly targets SLCO4C1			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-574	miRNA Mature ID	miR-574-5p
miRNA Sequence	UGAGUGUGUGUGUGUGAGUGUGU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 19	miR-578 directly targets SLCO4C1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-578	miRNA Mature ID	miR-578
miRNA Sequence	CUUCUUGUGCUCUAGGAUUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-615 directly targets SLCO4C1			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-615	miRNA Mature ID	miR-615-3p
miRNA Sequence	UCCGAGCCUGGGUCUCCCUCUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 21	miR-670 directly targets SLCO4C1			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-670	miRNA Mature ID	miR-670-5p
miRNA Sequence	GUCCCUGAGUGUAUGUGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-6752 directly targets SLCO4C1			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6752	miRNA Mature ID	miR-6752-3p
miRNA Sequence	UCCCUGCCCCCAUACUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-676 directly targets SLCO4C1			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-676	miRNA Mature ID	miR-676-5p
miRNA Sequence	UCUUCAACCUCAGGACUUGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-6858 directly targets SLCO4C1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6858	miRNA Mature ID	miR-6858-5p
miRNA Sequence	GUGAGGAGGGGCUGGCAGGGAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-7162 directly targets SLCO4C1			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7162	miRNA Mature ID	miR-7162-5p
miRNA Sequence	UGCUUCCUUUCUCAGCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
13	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
14	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
15	Identification of Host Micro RNAs That Differentiate HIV-1 and HIV-2 Infection Using Genome Expression Profiling Techniques. Viruses. 2016 May 2;8(5).
16	Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
17	A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
18	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
19	MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
20	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
21	Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
22	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence