Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0515 Transporter Info | ||||
| Gene Name | ATP10A | ||||
| Transporter Name | Probable phospholipid-transporting ATPase VA | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Colon cancer |
24 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg07626033) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 1.26E-03; Z-score: -2.27E+00 | ||
|
Methylation in Case |
5.04E-01 (Median) | Methylation in Control | 6.29E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg13685964) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 2.53E-03; Z-score: -1.61E+00 | ||
|
Methylation in Case |
7.65E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg01530032) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 5.50E-06; Z-score: -2.00E+00 | ||
|
Methylation in Case |
5.44E-01 (Median) | Methylation in Control | 6.14E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg01717150) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.07E+00 | Statistic Test | p-value: 1.97E-04; Z-score: 7.11E+00 | ||
|
Methylation in Case |
2.99E-01 (Median) | Methylation in Control | 9.74E-02 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg02671204) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.04E-03; Z-score: -7.59E-01 | ||
|
Methylation in Case |
5.22E-01 (Median) | Methylation in Control | 5.90E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg12604192) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 2.52E-03; Z-score: -1.86E+00 | ||
|
Methylation in Case |
5.06E-01 (Median) | Methylation in Control | 5.91E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg07061355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 1.03E-04; Z-score: -2.39E+00 | ||
|
Methylation in Case |
7.53E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg08710629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.67E+00 | Statistic Test | p-value: 3.92E-03; Z-score: -1.43E+00 | ||
|
Methylation in Case |
2.11E-01 (Median) | Methylation in Control | 3.53E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
1stExon (cg03040581) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 3.03E-04; Z-score: -2.68E+00 | ||
|
Methylation in Case |
7.25E-01 (Median) | Methylation in Control | 7.77E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
1stExon (cg06869796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 7.64E-04; Z-score: -2.27E+00 | ||
|
Methylation in Case |
7.29E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg09565111) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 3.12E-06; Z-score: -2.00E+00 | ||
|
Methylation in Case |
5.21E-01 (Median) | Methylation in Control | 6.59E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg02844593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.59E+00 | Statistic Test | p-value: 3.37E-06; Z-score: -3.60E+00 | ||
|
Methylation in Case |
4.07E-01 (Median) | Methylation in Control | 6.45E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg17403817) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 9.01E-06; Z-score: -2.92E+00 | ||
|
Methylation in Case |
6.21E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg04583232) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 1.17E-04; Z-score: 1.60E+00 | ||
|
Methylation in Case |
4.65E-01 (Median) | Methylation in Control | 3.81E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg00764668) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 1.70E-04; Z-score: -2.55E+00 | ||
|
Methylation in Case |
4.74E-01 (Median) | Methylation in Control | 5.32E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg15668533) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 4.35E-04; Z-score: 1.45E+00 | ||
|
Methylation in Case |
4.89E-01 (Median) | Methylation in Control | 4.13E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg01359329) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 5.94E-04; Z-score: -1.11E+00 | ||
|
Methylation in Case |
5.30E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg19866594) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 7.39E-04; Z-score: -3.20E+00 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg09170397) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.34E-03; Z-score: -1.11E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg16648603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 1.57E-03; Z-score: -1.94E+00 | ||
|
Methylation in Case |
6.45E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg11226148) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.42E+00 | Statistic Test | p-value: 1.96E-03; Z-score: 2.79E+00 | ||
|
Methylation in Case |
1.89E-01 (Median) | Methylation in Control | 1.33E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg24178621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 2.76E-03; Z-score: -2.58E+00 | ||
|
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 8.39E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg13716321) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.90E-03; Z-score: -9.38E-01 | ||
|
Methylation in Case |
5.91E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
3'UTR (cg20733663) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 4.48E-05; Z-score: -2.71E+00 | ||
|
Methylation in Case |
5.46E-01 (Median) | Methylation in Control | 6.21E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
45 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg01393327) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.67E+00 | Statistic Test | p-value: 1.32E-14; Z-score: 2.49E+00 | ||
|
Methylation in Case |
6.94E-01 (Median) | Methylation in Control | 4.16E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg24639117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.60E+00 | Statistic Test | p-value: 3.29E-11; Z-score: -3.54E+00 | ||
|
Methylation in Case |
3.82E-01 (Median) | Methylation in Control | 6.11E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg10949773) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 1.90E-15; Z-score: -2.96E+00 | ||
|
Methylation in Case |
5.70E-01 (Median) | Methylation in Control | 7.46E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg22337136) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.38E+00 | Statistic Test | p-value: 1.08E-13; Z-score: -1.73E+00 | ||
|
Methylation in Case |
1.93E-01 (Median) | Methylation in Control | 2.66E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg09282497) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.07E+00 | Statistic Test | p-value: 3.28E-12; Z-score: 4.04E+00 | ||
|
Methylation in Case |
2.29E-01 (Median) | Methylation in Control | 5.63E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg07470694) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.38E+00 | Statistic Test | p-value: 1.79E-09; Z-score: -4.17E+00 | ||
|
Methylation in Case |
6.02E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg26879349) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 1.94E-08; Z-score: -4.30E+00 | ||
|
Methylation in Case |
6.30E-01 (Median) | Methylation in Control | 7.99E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.94E+00 | Statistic Test | p-value: 2.76E-08; Z-score: 2.72E+00 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 6.66E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.67E+00 | Statistic Test | p-value: 1.12E-07; Z-score: 3.49E+00 | ||
|
Methylation in Case |
1.33E-01 (Median) | Methylation in Control | 7.94E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.60E+00 | Statistic Test | p-value: 2.52E-07; Z-score: 3.09E+00 | ||
|
Methylation in Case |
1.73E-01 (Median) | Methylation in Control | 1.08E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg08828036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.38E+00 | Statistic Test | p-value: 5.26E-07; Z-score: -1.71E+00 | ||
|
Methylation in Case |
4.16E-01 (Median) | Methylation in Control | 5.74E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 3.97E-06; Z-score: 1.66E+00 | ||
|
Methylation in Case |
1.13E-01 (Median) | Methylation in Control | 8.08E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 1.94E-04; Z-score: 4.31E-01 | ||
|
Methylation in Case |
6.21E-02 (Median) | Methylation in Control | 5.24E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 3.53E-04; Z-score: 5.67E-01 | ||
|
Methylation in Case |
4.93E-02 (Median) | Methylation in Control | 4.34E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.68E-03; Z-score: 1.58E-01 | ||
|
Methylation in Case |
7.95E-02 (Median) | Methylation in Control | 7.72E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg15523238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.40E-02; Z-score: -9.80E-02 | ||
|
Methylation in Case |
8.48E-02 (Median) | Methylation in Control | 8.68E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg19980771) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.60E+00 | Statistic Test | p-value: 1.87E-15; Z-score: 1.91E+00 | ||
|
Methylation in Case |
7.62E-01 (Median) | Methylation in Control | 4.77E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg16857852) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.56E+00 | Statistic Test | p-value: 3.83E-15; Z-score: -3.05E+00 | ||
|
Methylation in Case |
3.25E-01 (Median) | Methylation in Control | 5.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg03419058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.72E+00 | Statistic Test | p-value: 1.42E-08; Z-score: 1.61E+00 | ||
|
Methylation in Case |
1.04E-01 (Median) | Methylation in Control | 3.82E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg16389285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 1.97E-07; Z-score: 5.06E-01 | ||
|
Methylation in Case |
3.96E-02 (Median) | Methylation in Control | 2.83E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.31E+00 | Statistic Test | p-value: 3.74E-07; Z-score: 3.11E-01 | ||
|
Methylation in Case |
3.93E-02 (Median) | Methylation in Control | 3.00E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg26230285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 3.60E-06; Z-score: 2.54E-01 | ||
|
Methylation in Case |
3.67E-02 (Median) | Methylation in Control | 2.89E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg22113930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 5.12E-06; Z-score: 2.69E-01 | ||
|
Methylation in Case |
4.81E-02 (Median) | Methylation in Control | 4.08E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
1stExon (cg06835822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.46E+00 | Statistic Test | p-value: 1.18E-16; Z-score: -8.25E+00 | ||
|
Methylation in Case |
6.09E-01 (Median) | Methylation in Control | 8.87E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 1.02E-04; Z-score: 6.36E-03 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 1.29E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg24178621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.96E+00 | Statistic Test | p-value: 4.75E-24; Z-score: -7.09E+00 | ||
|
Methylation in Case |
4.02E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05099596) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.58E+00 | Statistic Test | p-value: 4.74E-17; Z-score: -5.02E+00 | ||
|
Methylation in Case |
4.06E-01 (Median) | Methylation in Control | 6.41E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg04077417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.56E+00 | Statistic Test | p-value: 4.35E-16; Z-score: -3.87E+00 | ||
|
Methylation in Case |
4.19E-01 (Median) | Methylation in Control | 6.53E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg14224786) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 5.81E-16; Z-score: -4.82E+00 | ||
|
Methylation in Case |
4.70E-01 (Median) | Methylation in Control | 6.21E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg20961940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 2.75E-15; Z-score: -3.21E+00 | ||
|
Methylation in Case |
3.67E-01 (Median) | Methylation in Control | 5.33E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg15420634) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.44E+00 | Statistic Test | p-value: 1.95E-14; Z-score: -3.34E+00 | ||
|
Methylation in Case |
4.38E-01 (Median) | Methylation in Control | 6.32E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg00378292) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 2.83E-14; Z-score: -2.43E+00 | ||
|
Methylation in Case |
2.45E-01 (Median) | Methylation in Control | 3.41E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg04524933) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 6.12E-14; Z-score: -1.05E+01 | ||
|
Methylation in Case |
6.96E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg13363904) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 4.30E-12; Z-score: -2.97E+00 | ||
|
Methylation in Case |
6.39E-01 (Median) | Methylation in Control | 7.84E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg15632787) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 1.47E-11; Z-score: -4.57E+00 | ||
|
Methylation in Case |
6.84E-01 (Median) | Methylation in Control | 8.41E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg11204913) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 2.11E-11; Z-score: -2.25E+00 | ||
|
Methylation in Case |
6.49E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg19156231) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.31E+00 | Statistic Test | p-value: 2.01E-10; Z-score: 1.72E+00 | ||
|
Methylation in Case |
4.98E-01 (Median) | Methylation in Control | 3.81E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01163597) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 3.15E-10; Z-score: -1.26E+00 | ||
|
Methylation in Case |
9.82E-02 (Median) | Methylation in Control | 1.30E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg21164967) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 5.07E-10; Z-score: -2.98E+00 | ||
|
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg03771731) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 5.38E-10; Z-score: -3.13E+00 | ||
|
Methylation in Case |
6.61E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg00602502) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 1.78E-09; Z-score: -2.65E+00 | ||
|
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 7.88E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 6.99E-06; Z-score: -1.46E+00 | ||
|
Methylation in Case |
3.34E-01 (Median) | Methylation in Control | 4.05E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02747151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 8.49E-05; Z-score: -7.23E-01 | ||
|
Methylation in Case |
7.09E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16727862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.45E-04; Z-score: 3.61E-01 | ||
|
Methylation in Case |
1.74E-01 (Median) | Methylation in Control | 1.69E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 45 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg23948362) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 1.36E-09; Z-score: -2.09E+00 | ||
|
Methylation in Case |
5.37E-01 (Median) | Methylation in Control | 6.68E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
68 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg13591783) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.31E+00 | Statistic Test | p-value: 4.58E-23; Z-score: -4.09E+00 | ||
|
Methylation in Case |
2.61E-01 (Median) | Methylation in Control | 6.04E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.97E+00 | Statistic Test | p-value: 5.22E-14; Z-score: 2.27E+00 | ||
|
Methylation in Case |
3.45E-01 (Median) | Methylation in Control | 1.75E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg25508319) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.92E+00 | Statistic Test | p-value: 2.15E-09; Z-score: -1.94E+00 | ||
|
Methylation in Case |
2.03E-01 (Median) | Methylation in Control | 5.92E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg02114946) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.74E+00 | Statistic Test | p-value: 1.98E-07; Z-score: -1.41E+00 | ||
|
Methylation in Case |
1.49E-01 (Median) | Methylation in Control | 2.59E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg10829727) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.84E+00 | Statistic Test | p-value: 1.34E-06; Z-score: -1.94E+00 | ||
|
Methylation in Case |
1.66E-01 (Median) | Methylation in Control | 3.06E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg00762738) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.51E+00 | Statistic Test | p-value: 2.16E-06; Z-score: 1.63E+00 | ||
|
Methylation in Case |
8.55E-01 (Median) | Methylation in Control | 5.66E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg23336810) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.18E-05; Z-score: -1.16E+00 | ||
|
Methylation in Case |
6.36E-01 (Median) | Methylation in Control | 7.20E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg00152041) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 4.62E-05; Z-score: -8.48E-01 | ||
|
Methylation in Case |
1.37E-01 (Median) | Methylation in Control | 1.82E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg12296552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 7.17E-04; Z-score: 7.50E-01 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 8.66E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg12518775) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.59E-03; Z-score: -2.80E-01 | ||
|
Methylation in Case |
4.82E-01 (Median) | Methylation in Control | 4.93E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg15982419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.38E+00 | Statistic Test | p-value: 2.14E-21; Z-score: -3.65E+00 | ||
|
Methylation in Case |
2.97E-01 (Median) | Methylation in Control | 4.09E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg25281171) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 1.39E-15; Z-score: 2.24E+00 | ||
|
Methylation in Case |
9.21E-02 (Median) | Methylation in Control | 7.15E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg23141183) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 9.95E-10; Z-score: -1.33E+00 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg20066612) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 3.97E-09; Z-score: -1.38E+00 | ||
|
Methylation in Case |
4.54E-01 (Median) | Methylation in Control | 5.29E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg08258650) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.61E+00 | Statistic Test | p-value: 1.33E-08; Z-score: 1.37E+00 | ||
|
Methylation in Case |
1.48E-01 (Median) | Methylation in Control | 9.17E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg20495009) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.37E-07; Z-score: -1.17E+00 | ||
|
Methylation in Case |
7.78E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg13993179) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 2.47E-07; Z-score: -1.40E+00 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 8.38E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.54E+00 | Statistic Test | p-value: 7.72E-05; Z-score: 1.45E+00 | ||
|
Methylation in Case |
3.26E-01 (Median) | Methylation in Control | 1.28E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg05591210) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 2.05E-04; Z-score: -1.14E+00 | ||
|
Methylation in Case |
7.16E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg24789128) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.30E-03; Z-score: 2.91E-01 | ||
|
Methylation in Case |
7.04E-02 (Median) | Methylation in Control | 6.55E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg03702545) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.83E-02; Z-score: 4.51E-01 | ||
|
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg24565369) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.48E+00 | Statistic Test | p-value: 8.03E-14; Z-score: 7.50E-01 | ||
|
Methylation in Case |
7.19E-02 (Median) | Methylation in Control | 4.85E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg15026150) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 1.70E-07; Z-score: 5.43E-01 | ||
|
Methylation in Case |
1.28E-01 (Median) | Methylation in Control | 1.03E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg21306329) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -5.18E+00 | Statistic Test | p-value: 2.48E-06; Z-score: -1.61E+00 | ||
|
Methylation in Case |
6.06E-02 (Median) | Methylation in Control | 3.14E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg05339727) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 1.21E-05; Z-score: -1.30E+00 | ||
|
Methylation in Case |
2.63E-01 (Median) | Methylation in Control | 3.68E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg14494721) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 5.40E-04; Z-score: 8.33E-01 | ||
|
Methylation in Case |
3.57E-01 (Median) | Methylation in Control | 3.00E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg14588399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 9.39E-04; Z-score: -5.83E-01 | ||
|
Methylation in Case |
4.84E-01 (Median) | Methylation in Control | 5.18E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg24363298) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 5.89E-03; Z-score: -5.59E-01 | ||
|
Methylation in Case |
1.55E-01 (Median) | Methylation in Control | 1.74E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
1stExon (cg24154937) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.47E+00 | Statistic Test | p-value: 5.69E-13; Z-score: 2.42E+00 | ||
|
Methylation in Case |
5.24E-01 (Median) | Methylation in Control | 3.58E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
1stExon (cg04874129) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.52E+00 | Statistic Test | p-value: 3.74E-08; Z-score: 1.43E+00 | ||
|
Methylation in Case |
4.11E-01 (Median) | Methylation in Control | 2.71E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
1stExon (cg13555101) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.18E-03; Z-score: -6.47E-01 | ||
|
Methylation in Case |
9.64E-02 (Median) | Methylation in Control | 1.06E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg23517752) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 4.54E-39; Z-score: -5.28E+00 | ||
|
Methylation in Case |
5.71E-01 (Median) | Methylation in Control | 7.34E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg00392377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 1.39E-13; Z-score: 1.83E+00 | ||
|
Methylation in Case |
3.30E-01 (Median) | Methylation in Control | 2.73E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg15022049) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 4.81E-13; Z-score: -2.26E+00 | ||
|
Methylation in Case |
8.03E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg01132471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.40E-10; Z-score: -1.59E+00 | ||
|
Methylation in Case |
6.56E-01 (Median) | Methylation in Control | 7.10E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg08362628) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 2.37E-10; Z-score: -1.45E+00 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 8.23E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg16680214) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.59E+00 | Statistic Test | p-value: 3.33E-10; Z-score: -1.91E+00 | ||
|
Methylation in Case |
1.98E-01 (Median) | Methylation in Control | 3.15E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg19272348) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.46E+00 | Statistic Test | p-value: 5.15E-10; Z-score: -1.99E+00 | ||
|
Methylation in Case |
4.77E-01 (Median) | Methylation in Control | 6.95E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg04602747) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 1.31E-08; Z-score: -1.46E+00 | ||
|
Methylation in Case |
3.06E-01 (Median) | Methylation in Control | 4.02E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg08895056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 3.84E-08; Z-score: -1.75E+00 | ||
|
Methylation in Case |
5.48E-01 (Median) | Methylation in Control | 6.54E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg12355681) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.00E+00 | Statistic Test | p-value: 6.01E-08; Z-score: -1.56E+00 | ||
|
Methylation in Case |
1.56E-01 (Median) | Methylation in Control | 3.11E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg11637076) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 1.13E-07; Z-score: -1.66E+00 | ||
|
Methylation in Case |
2.20E-01 (Median) | Methylation in Control | 2.84E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg00026803) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.23E+00 | Statistic Test | p-value: 3.68E-07; Z-score: 1.71E+00 | ||
|
Methylation in Case |
6.51E-01 (Median) | Methylation in Control | 5.31E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg05621157) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.02E+00 | Statistic Test | p-value: 7.53E-07; Z-score: -1.42E+00 | ||
|
Methylation in Case |
1.33E-01 (Median) | Methylation in Control | 2.68E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 45 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg16665234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.01E-06; Z-score: -5.52E-01 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 46 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.88E+00 | Statistic Test | p-value: 4.36E-06; Z-score: -1.66E+00 | ||
|
Methylation in Case |
2.11E-01 (Median) | Methylation in Control | 3.96E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 47 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg06018240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 5.25E-06; Z-score: 9.06E-01 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 48 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg09344281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 7.06E-06; Z-score: 1.45E+00 | ||
|
Methylation in Case |
6.32E-01 (Median) | Methylation in Control | 5.86E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 49 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg02641941) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 7.77E-06; Z-score: -1.12E+00 | ||
|
Methylation in Case |
5.59E-01 (Median) | Methylation in Control | 7.05E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 50 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg06888094) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.39E+00 | Statistic Test | p-value: 2.03E-05; Z-score: -1.17E+00 | ||
|
Methylation in Case |
2.32E-01 (Median) | Methylation in Control | 3.21E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 51 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg14387909) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 2.90E-05; Z-score: 1.43E+00 | ||
|
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 52 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg25350825) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 9.22E-05; Z-score: 9.23E-01 | ||
|
Methylation in Case |
8.46E-01 (Median) | Methylation in Control | 8.17E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 53 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg14574489) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.33E-04; Z-score: -6.63E-01 | ||
|
Methylation in Case |
5.08E-01 (Median) | Methylation in Control | 5.60E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 54 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg09152490) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.53E-04; Z-score: 5.89E-01 | ||
|
Methylation in Case |
6.55E-01 (Median) | Methylation in Control | 6.39E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 55 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg06903325) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.39E-04; Z-score: -6.74E-01 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 9.00E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 56 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg17306339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 1.04E-03; Z-score: 7.93E-01 | ||
|
Methylation in Case |
5.58E-01 (Median) | Methylation in Control | 4.92E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 57 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg07601645) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.13E-03; Z-score: -9.26E-01 | ||
|
Methylation in Case |
6.13E-01 (Median) | Methylation in Control | 6.55E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 58 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg16329782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.59E-03; Z-score: 6.49E-01 | ||
|
Methylation in Case |
6.30E-01 (Median) | Methylation in Control | 5.98E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 59 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg11491407) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 1.62E-03; Z-score: 7.63E-01 | ||
|
Methylation in Case |
4.18E-01 (Median) | Methylation in Control | 3.66E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 60 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg10634702) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.85E-03; Z-score: 6.13E-01 | ||
|
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 61 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg08830588) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 2.09E-03; Z-score: -1.12E+00 | ||
|
Methylation in Case |
5.91E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 62 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg12384004) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 3.62E-03; Z-score: 7.43E-01 | ||
|
Methylation in Case |
6.57E-01 (Median) | Methylation in Control | 6.16E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 63 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg09150064) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 4.82E-03; Z-score: 3.02E-01 | ||
|
Methylation in Case |
3.08E-01 (Median) | Methylation in Control | 2.94E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 64 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg19853440) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 3.82E-02; Z-score: 3.75E-01 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 65 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg00452252) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 4.16E-09; Z-score: -1.71E+00 | ||
|
Methylation in Case |
7.11E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 66 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg11673687) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 3.22E-08; Z-score: -1.58E+00 | ||
|
Methylation in Case |
5.68E-01 (Median) | Methylation in Control | 7.13E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 67 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg21880222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.31E+00 | Statistic Test | p-value: 8.78E-07; Z-score: 1.36E+00 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 6.15E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 68 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg19122460) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.65E-02; Z-score: -4.50E-01 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
78 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 5.03E+00 | Statistic Test | p-value: 2.85E-06; Z-score: 1.10E+01 | ||
|
Methylation in Case |
2.90E-01 (Median) | Methylation in Control | 5.77E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg24687432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.71E+00 | Statistic Test | p-value: 2.94E-06; Z-score: -4.83E+00 | ||
|
Methylation in Case |
4.20E-01 (Median) | Methylation in Control | 7.17E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg15523238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.48E+00 | Statistic Test | p-value: 6.93E-06; Z-score: 1.06E+01 | ||
|
Methylation in Case |
2.69E-01 (Median) | Methylation in Control | 6.00E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.74E+00 | Statistic Test | p-value: 1.13E-05; Z-score: 3.60E+01 | ||
|
Methylation in Case |
2.88E-01 (Median) | Methylation in Control | 6.08E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.38E+00 | Statistic Test | p-value: 2.24E-05; Z-score: 1.31E+01 | ||
|
Methylation in Case |
2.23E-01 (Median) | Methylation in Control | 9.38E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.88E+00 | Statistic Test | p-value: 3.10E-05; Z-score: 4.26E+00 | ||
|
Methylation in Case |
5.25E-01 (Median) | Methylation in Control | 1.08E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg18083248) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.18E+00 | Statistic Test | p-value: 6.40E-05; Z-score: 4.33E+00 | ||
|
Methylation in Case |
6.18E-01 (Median) | Methylation in Control | 2.84E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg17174275) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 7.86E-05; Z-score: -4.21E+00 | ||
|
Methylation in Case |
5.14E-01 (Median) | Methylation in Control | 6.98E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 1.15E-04; Z-score: -3.43E+00 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 7.77E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg09454187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 3.00E-04; Z-score: -3.86E+00 | ||
|
Methylation in Case |
6.34E-01 (Median) | Methylation in Control | 7.93E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.02E+00 | Statistic Test | p-value: 3.06E-04; Z-score: 5.56E+00 | ||
|
Methylation in Case |
2.01E-01 (Median) | Methylation in Control | 9.93E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg22797991) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.78E+00 | Statistic Test | p-value: 4.00E-04; Z-score: 8.71E+00 | ||
|
Methylation in Case |
1.90E-01 (Median) | Methylation in Control | 1.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg26519141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.26E+00 | Statistic Test | p-value: 4.68E-04; Z-score: 4.33E+00 | ||
|
Methylation in Case |
1.40E-01 (Median) | Methylation in Control | 6.22E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.92E+00 | Statistic Test | p-value: 5.75E-04; Z-score: 9.10E+00 | ||
|
Methylation in Case |
1.97E-01 (Median) | Methylation in Control | 1.03E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg26062856) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 1.13E-03; Z-score: -3.00E+00 | ||
|
Methylation in Case |
4.49E-01 (Median) | Methylation in Control | 5.94E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg18939241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 9.61E-03; Z-score: -2.40E+00 | ||
|
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 7.24E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 1.63E-02; Z-score: 1.16E+00 | ||
|
Methylation in Case |
7.57E-02 (Median) | Methylation in Control | 5.89E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.60E+00 | Statistic Test | p-value: 1.71E-02; Z-score: 2.93E+00 | ||
|
Methylation in Case |
7.50E-02 (Median) | Methylation in Control | 4.68E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.26E+01 | Statistic Test | p-value: 3.47E-04; Z-score: 1.34E+01 | ||
|
Methylation in Case |
1.32E-01 (Median) | Methylation in Control | 5.85E-03 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg03419058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 5.59E+00 | Statistic Test | p-value: 3.56E-04; Z-score: 2.67E+01 | ||
|
Methylation in Case |
1.20E-01 (Median) | Methylation in Control | 2.15E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg26230285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.49E+01 | Statistic Test | p-value: 6.80E-04; Z-score: 9.45E+00 | ||
|
Methylation in Case |
1.04E-01 (Median) | Methylation in Control | 6.99E-03 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg16389285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 5.68E+00 | Statistic Test | p-value: 1.18E-03; Z-score: 8.95E+00 | ||
|
Methylation in Case |
5.37E-02 (Median) | Methylation in Control | 9.46E-03 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg22113930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.07E+00 | Statistic Test | p-value: 1.94E-03; Z-score: 7.41E+00 | ||
|
Methylation in Case |
8.28E-02 (Median) | Methylation in Control | 2.70E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg01372572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.27E+00 | Statistic Test | p-value: 1.60E-14; Z-score: -2.60E+01 | ||
|
Methylation in Case |
2.92E-01 (Median) | Methylation in Control | 6.64E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg20117103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.88E+00 | Statistic Test | p-value: 1.66E-12; Z-score: -1.15E+01 | ||
|
Methylation in Case |
2.24E-01 (Median) | Methylation in Control | 6.44E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg03924551) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.10E+00 | Statistic Test | p-value: 3.36E-11; Z-score: -1.41E+01 | ||
|
Methylation in Case |
2.79E-01 (Median) | Methylation in Control | 5.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg11557546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.96E+00 | Statistic Test | p-value: 5.28E-11; Z-score: -9.96E+00 | ||
|
Methylation in Case |
3.29E-01 (Median) | Methylation in Control | 6.45E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.99E+00 | Statistic Test | p-value: 2.59E-10; Z-score: -1.24E+01 | ||
|
Methylation in Case |
3.85E-01 (Median) | Methylation in Control | 7.68E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg16988989) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.72E+00 | Statistic Test | p-value: 2.67E-10; Z-score: -1.47E+01 | ||
|
Methylation in Case |
4.68E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg12860764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.23E+00 | Statistic Test | p-value: 4.56E-10; Z-score: -7.87E+00 | ||
|
Methylation in Case |
3.09E-01 (Median) | Methylation in Control | 6.89E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg04218022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.66E+00 | Statistic Test | p-value: 1.00E-09; Z-score: -2.00E+01 | ||
|
Methylation in Case |
5.19E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg13060434) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.88E+00 | Statistic Test | p-value: 3.72E-09; Z-score: -8.41E+00 | ||
|
Methylation in Case |
2.83E-01 (Median) | Methylation in Control | 5.33E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg07489029) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.46E+00 | Statistic Test | p-value: 4.10E-09; Z-score: -9.36E+00 | ||
|
Methylation in Case |
5.93E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg11015241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.51E+00 | Statistic Test | p-value: 5.77E-09; Z-score: -3.95E+01 | ||
|
Methylation in Case |
5.98E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg23158862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.52E+00 | Statistic Test | p-value: 5.96E-09; Z-score: -2.13E+01 | ||
|
Methylation in Case |
5.59E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26478036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 2.97E-08; Z-score: -1.21E+01 | ||
|
Methylation in Case |
6.01E-01 (Median) | Methylation in Control | 8.01E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg16605633) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 9.82E-08; Z-score: -5.79E+00 | ||
|
Methylation in Case |
4.99E-01 (Median) | Methylation in Control | 6.76E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg18749411) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 1.05E-07; Z-score: -1.41E+01 | ||
|
Methylation in Case |
6.61E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg08831522) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 1.53E-07; Z-score: -9.25E+00 | ||
|
Methylation in Case |
6.42E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg12933431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 2.07E-07; Z-score: -4.74E+00 | ||
|
Methylation in Case |
4.79E-01 (Median) | Methylation in Control | 7.10E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.63E+00 | Statistic Test | p-value: 3.84E-07; Z-score: -5.40E+00 | ||
|
Methylation in Case |
3.04E-01 (Median) | Methylation in Control | 4.97E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg17805836) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 6.72E-07; Z-score: -1.06E+01 | ||
|
Methylation in Case |
6.84E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg07100560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 8.75E-07; Z-score: -1.91E+01 | ||
|
Methylation in Case |
7.59E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg07318335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 1.01E-06; Z-score: -9.65E+00 | ||
|
Methylation in Case |
7.18E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 45 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg27323557) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 2.04E-06; Z-score: -3.93E+01 | ||
|
Methylation in Case |
7.60E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 46 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg01364202) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 2.08E-06; Z-score: -1.33E+01 | ||
|
Methylation in Case |
6.81E-01 (Median) | Methylation in Control | 8.87E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 47 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg02107240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 2.91E-06; Z-score: -6.90E+00 | ||
|
Methylation in Case |
5.85E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 48 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg11442877) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 2.96E-06; Z-score: -1.04E+01 | ||
|
Methylation in Case |
6.73E-01 (Median) | Methylation in Control | 8.29E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 49 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg24602704) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 5.99E-06; Z-score: -1.87E+01 | ||
|
Methylation in Case |
7.18E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 50 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.42E+00 | Statistic Test | p-value: 6.85E-06; Z-score: -6.52E+00 | ||
|
Methylation in Case |
5.18E-01 (Median) | Methylation in Control | 7.36E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 51 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg16397021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 8.60E-06; Z-score: -1.27E+01 | ||
|
Methylation in Case |
7.63E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 52 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg25703338) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 8.61E-06; Z-score: -6.65E+00 | ||
|
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 9.00E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 53 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg23880822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.44E-05; Z-score: -8.92E+00 | ||
|
Methylation in Case |
8.15E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 54 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg09978546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 1.60E-05; Z-score: -7.18E+00 | ||
|
Methylation in Case |
7.70E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 55 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg17864405) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 2.86E-05; Z-score: -1.01E+01 | ||
|
Methylation in Case |
6.93E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 56 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg14001035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 3.12E-05; Z-score: -4.97E+00 | ||
|
Methylation in Case |
6.89E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 57 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg02208504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 4.46E-05; Z-score: -4.16E+00 | ||
|
Methylation in Case |
4.37E-01 (Median) | Methylation in Control | 5.63E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 58 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg16395892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 5.15E-05; Z-score: -7.44E+00 | ||
|
Methylation in Case |
8.02E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 59 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 6.23E-05; Z-score: -7.20E+00 | ||
|
Methylation in Case |
6.31E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 60 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg20119871) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 7.22E-05; Z-score: -4.27E+00 | ||
|
Methylation in Case |
5.97E-01 (Median) | Methylation in Control | 7.10E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 61 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 1.28E-04; Z-score: -4.81E+00 | ||
|
Methylation in Case |
3.96E-01 (Median) | Methylation in Control | 5.58E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 62 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg16651441) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 1.89E-04; Z-score: -3.10E+00 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 63 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg19930802) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 4.79E-04; Z-score: -5.11E+00 | ||
|
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 64 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg24576051) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 7.89E-04; Z-score: -2.60E+00 | ||
|
Methylation in Case |
6.07E-01 (Median) | Methylation in Control | 7.18E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 65 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg01206944) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.13E+00 | Statistic Test | p-value: 1.08E-03; Z-score: -2.55E+00 | ||
|
Methylation in Case |
1.78E-01 (Median) | Methylation in Control | 3.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 66 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26336213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.21E-03; Z-score: -3.93E+00 | ||
|
Methylation in Case |
8.79E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 67 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg12582965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.80E-03; Z-score: -1.30E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 68 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg17260954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.80E-03; Z-score: -4.06E+00 | ||
|
Methylation in Case |
8.41E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 69 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.80E-03; Z-score: -1.57E+00 | ||
|
Methylation in Case |
9.69E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 70 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg15275965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.51E+00 | Statistic Test | p-value: 2.02E-03; Z-score: -2.80E+00 | ||
|
Methylation in Case |
4.19E-01 (Median) | Methylation in Control | 6.32E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 71 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg14216870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 7.94E-03; Z-score: -3.60E+00 | ||
|
Methylation in Case |
9.52E-01 (Median) | Methylation in Control | 9.71E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 72 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg01788205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.22E-02; Z-score: -1.27E+00 | ||
|
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 73 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg19326876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 1.52E-02; Z-score: 9.83E-01 | ||
|
Methylation in Case |
1.61E-01 (Median) | Methylation in Control | 1.40E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 74 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg10473100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.56E-02; Z-score: -8.88E-01 | ||
|
Methylation in Case |
9.73E-01 (Median) | Methylation in Control | 9.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 75 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg00602502) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 3.49E-02; Z-score: 1.27E+00 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 76 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 3.50E-02; Z-score: 1.21E+00 | ||
|
Methylation in Case |
5.60E-01 (Median) | Methylation in Control | 4.58E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 77 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 2.53E-08; Z-score: -2.72E+01 | ||
|
Methylation in Case |
6.29E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 78 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg04223222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 9.02E-07; Z-score: -1.07E+01 | ||
|
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
76 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.61E+00 | Statistic Test | p-value: 1.83E-09; Z-score: 2.32E+00 | ||
|
Methylation in Case |
8.82E-02 (Median) | Methylation in Control | 5.48E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg18083248) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.30E+00 | Statistic Test | p-value: 5.69E-09; Z-score: 1.49E+00 | ||
|
Methylation in Case |
4.93E-01 (Median) | Methylation in Control | 3.81E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 9.84E-07; Z-score: 1.14E+00 | ||
|
Methylation in Case |
8.49E-02 (Median) | Methylation in Control | 6.71E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg15523238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 6.31E-06; Z-score: 7.69E-01 | ||
|
Methylation in Case |
9.52E-02 (Median) | Methylation in Control | 7.84E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 8.07E-06; Z-score: 8.58E-01 | ||
|
Methylation in Case |
9.58E-02 (Median) | Methylation in Control | 7.62E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg26519141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 2.83E-05; Z-score: 8.33E-01 | ||
|
Methylation in Case |
1.24E-01 (Median) | Methylation in Control | 9.96E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 2.85E-05; Z-score: 5.05E-01 | ||
|
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 1.90E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 1.78E-04; Z-score: 4.22E-01 | ||
|
Methylation in Case |
5.94E-02 (Median) | Methylation in Control | 5.06E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 6.58E-04; Z-score: 1.00E-01 | ||
|
Methylation in Case |
7.71E-02 (Median) | Methylation in Control | 7.47E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg22797991) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 1.15E-03; Z-score: 5.19E-01 | ||
|
Methylation in Case |
1.09E-01 (Median) | Methylation in Control | 1.00E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 5.28E-03; Z-score: -8.42E-01 | ||
|
Methylation in Case |
6.74E-01 (Median) | Methylation in Control | 7.09E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg24687432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 7.16E-03; Z-score: -4.76E-01 | ||
|
Methylation in Case |
5.66E-01 (Median) | Methylation in Control | 6.08E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg09454187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 8.25E-03; Z-score: -7.48E-03 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg17174275) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.59E-02; Z-score: -5.92E-01 | ||
|
Methylation in Case |
5.89E-01 (Median) | Methylation in Control | 6.21E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.65E-02; Z-score: 1.78E-01 | ||
|
Methylation in Case |
4.46E-02 (Median) | Methylation in Control | 4.21E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS200 (cg03419058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.82E+00 | Statistic Test | p-value: 2.60E-05; Z-score: 8.45E-01 | ||
|
Methylation in Case |
3.85E-02 (Median) | Methylation in Control | 2.12E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 3.03E-04; Z-score: 4.73E-01 | ||
|
Methylation in Case |
2.36E-02 (Median) | Methylation in Control | 1.77E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS200 (cg26230285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.51E+00 | Statistic Test | p-value: 3.22E-04; Z-score: 6.55E-01 | ||
|
Methylation in Case |
2.64E-02 (Median) | Methylation in Control | 1.74E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS200 (cg16389285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 4.18E-04; Z-score: 5.45E-01 | ||
|
Methylation in Case |
1.50E-02 (Median) | Methylation in Control | 1.04E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS200 (cg22113930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.69E+00 | Statistic Test | p-value: 5.69E-04; Z-score: 1.05E+00 | ||
|
Methylation in Case |
5.02E-02 (Median) | Methylation in Control | 2.97E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.44E-02; Z-score: 1.14E-01 | ||
|
Methylation in Case |
1.30E-01 (Median) | Methylation in Control | 1.27E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg07986058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.41E+00 | Statistic Test | p-value: 3.22E-12; Z-score: 2.80E+00 | ||
|
Methylation in Case |
1.77E-01 (Median) | Methylation in Control | 7.36E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01372572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 1.70E-10; Z-score: -2.34E+00 | ||
|
Methylation in Case |
5.45E-01 (Median) | Methylation in Control | 6.33E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg13060434) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 4.07E-10; Z-score: -2.03E+00 | ||
|
Methylation in Case |
6.51E-01 (Median) | Methylation in Control | 7.97E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 6.28E-10; Z-score: -1.65E+00 | ||
|
Methylation in Case |
6.27E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 2.08E-09; Z-score: -1.82E+00 | ||
|
Methylation in Case |
3.01E-01 (Median) | Methylation in Control | 3.90E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg16988989) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 7.32E-09; Z-score: -1.75E+00 | ||
|
Methylation in Case |
7.05E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg20117103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.84E+00 | Statistic Test | p-value: 3.25E-08; Z-score: -1.64E+00 | ||
|
Methylation in Case |
2.68E-01 (Median) | Methylation in Control | 4.93E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg18256640) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 6.52E-08; Z-score: 2.14E+00 | ||
|
Methylation in Case |
8.49E-01 (Median) | Methylation in Control | 6.74E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01364202) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.43E-07; Z-score: -1.78E+00 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg11015241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.92E-07; Z-score: -2.45E+00 | ||
|
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg04218022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 5.06E-07; Z-score: -1.35E+00 | ||
|
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 8.28E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg08831522) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 8.64E-07; Z-score: -1.30E+00 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg17805836) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.08E-06; Z-score: -1.54E+00 | ||
|
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 8.98E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg17864405) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.57E-06; Z-score: -9.48E-01 | ||
|
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 1.60E-06; Z-score: -1.22E+00 | ||
|
Methylation in Case |
6.38E-01 (Median) | Methylation in Control | 7.48E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg16395892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 4.52E-06; Z-score: -1.24E+00 | ||
|
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg11442877) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 4.95E-06; Z-score: -8.51E-01 | ||
|
Methylation in Case |
7.66E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg12582965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 5.24E-06; Z-score: -1.06E+00 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg20119871) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.04E-05; Z-score: -9.25E-01 | ||
|
Methylation in Case |
7.09E-01 (Median) | Methylation in Control | 7.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26478036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.24E-05; Z-score: -7.28E-01 | ||
|
Methylation in Case |
7.45E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg20696050) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.25E-05; Z-score: -1.42E+00 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg27323557) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.82E-05; Z-score: -9.63E-01 | ||
|
Methylation in Case |
8.69E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26913186) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.83E-05; Z-score: -9.20E-01 | ||
|
Methylation in Case |
8.50E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 45 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01206944) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 3.23E-05; Z-score: 5.42E-01 | ||
|
Methylation in Case |
3.45E-01 (Median) | Methylation in Control | 2.89E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 46 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg07100560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.06E-05; Z-score: -8.87E-01 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 47 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg23158862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 4.51E-05; Z-score: -9.68E-01 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 8.46E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 48 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg14001035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 5.26E-05; Z-score: -1.34E+00 | ||
|
Methylation in Case |
6.78E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 49 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 5.97E-05; Z-score: -1.21E+00 | ||
|
Methylation in Case |
6.46E-01 (Median) | Methylation in Control | 7.26E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 50 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg07489029) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 7.33E-05; Z-score: -9.75E-01 | ||
|
Methylation in Case |
7.61E-01 (Median) | Methylation in Control | 7.90E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 51 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 9.88E-05; Z-score: -8.78E-01 | ||
|
Methylation in Case |
6.88E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 52 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg20049422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 1.21E-04; Z-score: -8.89E-01 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 53 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg19930802) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.46E-04; Z-score: -2.70E-01 | ||
|
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 54 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 1.86E-04; Z-score: 1.29E+00 | ||
|
Methylation in Case |
4.95E-01 (Median) | Methylation in Control | 4.30E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 55 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg17260954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.13E-04; Z-score: -7.69E-01 | ||
|
Methylation in Case |
8.45E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 56 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26336213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.51E-04; Z-score: -9.60E-01 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.05E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 57 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg18749411) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 4.11E-04; Z-score: -5.49E-01 | ||
|
Methylation in Case |
7.90E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 58 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg11557546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 8.48E-04; Z-score: -9.17E-01 | ||
|
Methylation in Case |
5.53E-01 (Median) | Methylation in Control | 6.00E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 59 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg13825334) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.28E-03; Z-score: -9.37E-01 | ||
|
Methylation in Case |
8.47E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 60 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg23880822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.64E-03; Z-score: -7.50E-01 | ||
|
Methylation in Case |
8.77E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 61 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg24602704) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 2.02E-03; Z-score: -8.63E-01 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 62 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg10473100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.30E-03; Z-score: -1.07E+00 | ||
|
Methylation in Case |
9.70E-01 (Median) | Methylation in Control | 9.80E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 63 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg05626764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 3.26E-03; Z-score: 2.10E-01 | ||
|
Methylation in Case |
3.48E-02 (Median) | Methylation in Control | 2.79E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 64 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg15338782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 3.57E-03; Z-score: 7.09E-01 | ||
|
Methylation in Case |
5.30E-01 (Median) | Methylation in Control | 4.69E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 65 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg02287939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 4.10E-03; Z-score: -1.27E+00 | ||
|
Methylation in Case |
9.51E-01 (Median) | Methylation in Control | 9.81E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 66 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg02107240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 5.77E-03; Z-score: -3.13E-01 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 67 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01788205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 6.25E-03; Z-score: -9.99E-01 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 68 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg16605633) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 6.44E-03; Z-score: -9.08E-01 | ||
|
Methylation in Case |
6.12E-01 (Median) | Methylation in Control | 7.33E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 69 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg16397021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 8.20E-03; Z-score: -5.75E-01 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 70 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg07318335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 9.04E-03; Z-score: -2.74E-01 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 71 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.02E-02; Z-score: -2.85E-01 | ||
|
Methylation in Case |
9.48E-01 (Median) | Methylation in Control | 9.75E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 72 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg15275965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.91E-02; Z-score: -3.58E-01 | ||
|
Methylation in Case |
6.56E-01 (Median) | Methylation in Control | 6.88E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 73 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (ch.15.89498F) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 3.79E-02; Z-score: -3.53E-01 | ||
|
Methylation in Case |
2.74E-02 (Median) | Methylation in Control | 3.40E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 74 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg12860764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 4.02E-02; Z-score: -1.17E+00 | ||
|
Methylation in Case |
4.87E-01 (Median) | Methylation in Control | 6.49E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 75 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 4.86E-05; Z-score: -1.08E+00 | ||
|
Methylation in Case |
8.46E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 76 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg04223222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.07E-04; Z-score: -1.17E+00 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Celiac disease |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in celiac disease | [ 6 ] | |||
|
Location |
TSS1500 (cg18083248) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.48E+00 | Statistic Test | p-value: 2.53E-02; Z-score: 1.14E+00 | ||
|
Methylation in Case |
4.63E-01 (Median) | Methylation in Control | 3.13E-01 (Median) | ||
|
Studied Phenotype |
Celiac disease [ ICD-11: DA95] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
25 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg08828036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 3.44E-06; Z-score: 2.18E+00 | ||
|
Methylation in Case |
6.73E-01 (Median) | Methylation in Control | 5.11E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg26879349) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 3.60E-06; Z-score: 1.96E+00 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 7.40E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.15E+00 | Statistic Test | p-value: 7.20E-06; Z-score: 2.10E+00 | ||
|
Methylation in Case |
1.72E-01 (Median) | Methylation in Control | 8.03E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg26062856) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 1.29E-05; Z-score: 2.30E+00 | ||
|
Methylation in Case |
6.51E-01 (Median) | Methylation in Control | 5.73E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg22797991) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 1.59E-04; Z-score: 1.05E+00 | ||
|
Methylation in Case |
6.53E-02 (Median) | Methylation in Control | 5.19E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg17174275) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 4.42E-04; Z-score: 1.48E+00 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 6.15E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.60E+00 | Statistic Test | p-value: 1.02E-03; Z-score: 1.62E+00 | ||
|
Methylation in Case |
3.17E-02 (Median) | Methylation in Control | 1.99E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg15523238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 1.72E-03; Z-score: 2.89E-01 | ||
|
Methylation in Case |
2.94E-02 (Median) | Methylation in Control | 2.67E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg18939241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 2.71E-03; Z-score: 2.25E+00 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 5.68E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg18083248) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 3.63E-03; Z-score: 2.62E+00 | ||
|
Methylation in Case |
5.02E-01 (Median) | Methylation in Control | 3.88E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 4.64E-03; Z-score: 7.35E-01 | ||
|
Methylation in Case |
3.35E-02 (Median) | Methylation in Control | 2.98E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg24687432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 4.79E-03; Z-score: 1.46E+00 | ||
|
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 6.86E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg26519141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 8.33E-03; Z-score: 5.78E-01 | ||
|
Methylation in Case |
7.40E-02 (Median) | Methylation in Control | 6.31E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 8.91E-03; Z-score: 5.65E-01 | ||
|
Methylation in Case |
4.85E-02 (Median) | Methylation in Control | 4.25E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 1.25E-02; Z-score: 8.73E-01 | ||
|
Methylation in Case |
3.18E-02 (Median) | Methylation in Control | 2.41E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 1.74E-02; Z-score: 5.66E-01 | ||
|
Methylation in Case |
1.23E-02 (Median) | Methylation in Control | 1.11E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg09454187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.77E-02; Z-score: 1.20E+00 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 1.90E-02; Z-score: 6.94E-01 | ||
|
Methylation in Case |
3.45E-02 (Median) | Methylation in Control | 2.90E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 1.96E-02; Z-score: 7.05E-01 | ||
|
Methylation in Case |
2.24E-02 (Median) | Methylation in Control | 1.92E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 4.54E-02; Z-score: 4.01E-01 | ||
|
Methylation in Case |
2.04E-02 (Median) | Methylation in Control | 1.87E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 8.27E-04; Z-score: 6.95E-01 | ||
|
Methylation in Case |
9.08E-02 (Median) | Methylation in Control | 7.93E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 5.11E-04; Z-score: -5.66E-01 | ||
|
Methylation in Case |
9.78E-01 (Median) | Methylation in Control | 9.79E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg27323557) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 6.68E-03; Z-score: -6.08E-01 | ||
|
Methylation in Case |
9.75E-01 (Median) | Methylation in Control | 9.80E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg19326876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.01E-02; Z-score: 3.96E-01 | ||
|
Methylation in Case |
7.71E-02 (Median) | Methylation in Control | 6.81E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg17864405) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 2.69E-02; Z-score: -3.70E-01 | ||
|
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.48E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
77 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg24687432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 6.35E-16; Z-score: -6.02E+00 | ||
|
Methylation in Case |
6.58E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 4.27E-15; Z-score: -4.66E+00 | ||
|
Methylation in Case |
7.62E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg26062856) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 3.50E-11; Z-score: -2.94E+00 | ||
|
Methylation in Case |
7.19E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg17174275) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 3.50E-10; Z-score: -2.67E+00 | ||
|
Methylation in Case |
7.75E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.19E+00 | Statistic Test | p-value: 3.32E-09; Z-score: 2.02E+00 | ||
|
Methylation in Case |
4.37E-01 (Median) | Methylation in Control | 2.00E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg09454187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 4.28E-08; Z-score: -3.83E+00 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.28E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.07E+00 | Statistic Test | p-value: 2.06E-07; Z-score: 1.81E+00 | ||
|
Methylation in Case |
3.73E-01 (Median) | Methylation in Control | 1.80E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.77E+00 | Statistic Test | p-value: 2.92E-07; Z-score: 1.69E+00 | ||
|
Methylation in Case |
6.17E-01 (Median) | Methylation in Control | 3.48E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg18939241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 3.82E-07; Z-score: -1.77E+00 | ||
|
Methylation in Case |
8.15E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.68E+00 | Statistic Test | p-value: 3.19E-06; Z-score: 1.72E+00 | ||
|
Methylation in Case |
6.44E-01 (Median) | Methylation in Control | 3.82E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.07E+00 | Statistic Test | p-value: 3.36E-06; Z-score: 1.40E+00 | ||
|
Methylation in Case |
1.96E-01 (Median) | Methylation in Control | 9.46E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg26519141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.36E+00 | Statistic Test | p-value: 2.25E-05; Z-score: 1.01E+00 | ||
|
Methylation in Case |
4.73E-01 (Median) | Methylation in Control | 3.48E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.51E+00 | Statistic Test | p-value: 6.21E-05; Z-score: 1.17E+00 | ||
|
Methylation in Case |
6.25E-01 (Median) | Methylation in Control | 4.13E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg15523238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.48E+00 | Statistic Test | p-value: 1.05E-04; Z-score: 1.32E+00 | ||
|
Methylation in Case |
6.49E-01 (Median) | Methylation in Control | 4.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg22797991) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 3.38E-03; Z-score: 6.09E-01 | ||
|
Methylation in Case |
4.45E-01 (Median) | Methylation in Control | 3.75E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 1.19E-02; Z-score: 7.82E-01 | ||
|
Methylation in Case |
4.60E-01 (Median) | Methylation in Control | 3.71E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.31E+00 | Statistic Test | p-value: 2.89E-02; Z-score: 7.30E-01 | ||
|
Methylation in Case |
5.57E-01 (Median) | Methylation in Control | 4.25E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS200 (cg16389285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.71E+00 | Statistic Test | p-value: 3.48E-12; Z-score: 2.94E+00 | ||
|
Methylation in Case |
3.70E-01 (Median) | Methylation in Control | 9.99E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS200 (cg22113930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.09E+00 | Statistic Test | p-value: 5.82E-11; Z-score: 2.63E+00 | ||
|
Methylation in Case |
5.33E-01 (Median) | Methylation in Control | 1.73E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.71E+00 | Statistic Test | p-value: 7.61E-10; Z-score: 2.14E+00 | ||
|
Methylation in Case |
4.35E-01 (Median) | Methylation in Control | 1.60E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS200 (cg26230285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.48E+00 | Statistic Test | p-value: 5.51E-09; Z-score: 2.01E+00 | ||
|
Methylation in Case |
5.10E-01 (Median) | Methylation in Control | 2.06E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS200 (cg03419058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.35E+00 | Statistic Test | p-value: 1.30E-07; Z-score: 1.84E+00 | ||
|
Methylation in Case |
5.85E-01 (Median) | Methylation in Control | 2.49E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.61E+00 | Statistic Test | p-value: 4.52E-10; Z-score: 2.19E+00 | ||
|
Methylation in Case |
6.73E-01 (Median) | Methylation in Control | 4.18E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg01372572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 2.85E-17; Z-score: -4.57E+00 | ||
|
Methylation in Case |
6.01E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16988989) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 1.44E-16; Z-score: -8.90E+00 | ||
|
Methylation in Case |
7.33E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg11557546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 1.22E-15; Z-score: -4.90E+00 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 2.87E-14; Z-score: -4.45E+00 | ||
|
Methylation in Case |
5.98E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg12933431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 2.28E-12; Z-score: -3.49E+00 | ||
|
Methylation in Case |
6.68E-01 (Median) | Methylation in Control | 8.00E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg07489029) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 3.24E-12; Z-score: -5.26E+00 | ||
|
Methylation in Case |
8.50E-01 (Median) | Methylation in Control | 9.22E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg04218022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 4.97E-12; Z-score: -7.81E+00 | ||
|
Methylation in Case |
8.00E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg20119871) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 2.34E-11; Z-score: -5.93E+00 | ||
|
Methylation in Case |
8.00E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg13060434) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 2.53E-11; Z-score: -2.89E+00 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 8.15E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg26478036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 3.22E-11; Z-score: -2.83E+00 | ||
|
Methylation in Case |
7.12E-01 (Median) | Methylation in Control | 8.17E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 4.46E-11; Z-score: -2.73E+00 | ||
|
Methylation in Case |
7.06E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg02107240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 4.51E-11; Z-score: -3.77E+00 | ||
|
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg15275965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 4.63E-11; Z-score: -2.58E+00 | ||
|
Methylation in Case |
7.68E-01 (Median) | Methylation in Control | 8.79E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg23158862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 5.59E-11; Z-score: -9.81E+00 | ||
|
Methylation in Case |
8.19E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg18749411) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.23E-10; Z-score: -4.60E+00 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.36E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16605633) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 2.32E-10; Z-score: -2.34E+00 | ||
|
Methylation in Case |
7.68E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg11015241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 5.88E-10; Z-score: -9.18E+00 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 9.45E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg17805836) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 8.18E-08; Z-score: -7.00E+00 | ||
|
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.18E-07; Z-score: -1.69E+00 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 8.02E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg14001035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.64E-07; Z-score: -1.94E+00 | ||
|
Methylation in Case |
7.98E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg02208504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.65E-07; Z-score: -3.03E+00 | ||
|
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 45 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg19326876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.57E+00 | Statistic Test | p-value: 1.90E-07; Z-score: 1.56E+00 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 4.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 46 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg12582965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.35E-07; Z-score: -2.20E+00 | ||
|
Methylation in Case |
9.22E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 47 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg11442877) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.38E-07; Z-score: -2.31E+00 | ||
|
Methylation in Case |
9.04E-01 (Median) | Methylation in Control | 9.28E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 48 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg12860764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 8.62E-07; Z-score: -1.51E+00 | ||
|
Methylation in Case |
7.91E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 49 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg24602704) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.26E-06; Z-score: -2.18E+00 | ||
|
Methylation in Case |
8.46E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 50 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg19930802) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.74E-06; Z-score: -2.26E+00 | ||
|
Methylation in Case |
9.19E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 51 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg25703338) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 4.17E-06; Z-score: -1.81E+00 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 52 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16397021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 7.33E-06; Z-score: -1.19E+00 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 53 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg01364202) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 8.40E-06; Z-score: -2.61E+00 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 9.35E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 54 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg27323557) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.34E-05; Z-score: -1.68E+00 | ||
|
Methylation in Case |
9.22E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 55 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg08831522) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.39E-05; Z-score: -8.68E-01 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 56 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 5.79E-05; Z-score: -1.09E+00 | ||
|
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 57 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg17864405) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.08E-04; Z-score: -5.77E-01 | ||
|
Methylation in Case |
8.95E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 58 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg01206944) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.49E+00 | Statistic Test | p-value: 1.26E-04; Z-score: -1.43E+00 | ||
|
Methylation in Case |
2.67E-01 (Median) | Methylation in Control | 3.99E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 59 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16651441) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.97E-04; Z-score: -7.82E-01 | ||
|
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 60 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg20117103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.38E+00 | Statistic Test | p-value: 2.88E-04; Z-score: -1.19E+00 | ||
|
Methylation in Case |
4.34E-01 (Median) | Methylation in Control | 5.97E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 61 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16395892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.08E-04; Z-score: -1.56E+00 | ||
|
Methylation in Case |
9.40E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 62 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg07100560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.85E-04; Z-score: -1.12E+00 | ||
|
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 63 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 5.33E-04; Z-score: -9.93E-01 | ||
|
Methylation in Case |
8.20E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 64 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 6.72E-04; Z-score: -5.60E-01 | ||
|
Methylation in Case |
9.76E-01 (Median) | Methylation in Control | 9.78E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 65 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg01788205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.03E-03; Z-score: -2.43E-01 | ||
|
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 66 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg20049422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.21E-03; Z-score: -8.61E-01 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 67 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg09978546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.49E-03; Z-score: -8.66E-01 | ||
|
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 68 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 1.88E-03; Z-score: 8.64E-01 | ||
|
Methylation in Case |
7.14E-01 (Median) | Methylation in Control | 6.17E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 69 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg17260954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.16E-03; Z-score: -9.40E-01 | ||
|
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 70 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg11817038) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.50E-03; Z-score: -4.83E-01 | ||
|
Methylation in Case |
9.22E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 71 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg23880822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 6.48E-03; Z-score: -5.87E-01 | ||
|
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.52E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 72 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg20696050) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 7.77E-03; Z-score: -3.63E-01 | ||
|
Methylation in Case |
9.00E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 73 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg26913186) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 1.30E-02; Z-score: 1.86E-02 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 74 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg07986058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.11E-02; Z-score: 8.99E-02 | ||
|
Methylation in Case |
3.59E-01 (Median) | Methylation in Control | 3.51E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 75 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.59E-05; Z-score: -1.08E+00 | ||
|
Methylation in Case |
8.57E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 76 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
3'UTR (cg04223222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 6.37E-04; Z-score: -1.44E+00 | ||
|
Methylation in Case |
9.21E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in depression | [ 9 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 6.93E-03; Z-score: 5.29E-01 | ||
|
Methylation in Case |
1.01E-01 (Median) | Methylation in Control | 9.04E-02 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in depression | [ 9 ] | |||
|
Location |
TSS1500 (cg09638395) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.97E-02; Z-score: 2.49E-01 | ||
|
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in depression | [ 9 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.77E-02; Z-score: 4.79E-01 | ||
|
Methylation in Case |
7.09E-01 (Median) | Methylation in Control | 6.96E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in depression | [ 9 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.63E-03; Z-score: 6.28E-01 | ||
|
Methylation in Case |
9.59E-02 (Median) | Methylation in Control | 8.94E-02 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in depression | [ 9 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 2.94E-03; Z-score: 7.03E-01 | ||
|
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 2.13E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in depression | [ 9 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.25E-02; Z-score: -4.89E-01 | ||
|
Methylation in Case |
8.02E-01 (Median) | Methylation in Control | 8.17E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
55 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.46E+00 | Statistic Test | p-value: 3.27E-07; Z-score: 4.60E+00 | ||
|
Methylation in Case |
2.30E-01 (Median) | Methylation in Control | 9.37E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg18083248) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 1.95E-05; Z-score: 2.09E+00 | ||
|
Methylation in Case |
4.55E-01 (Median) | Methylation in Control | 3.58E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg17174275) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.52E-04; Z-score: -1.25E+00 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 7.27E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 1.65E-03; Z-score: 1.78E+00 | ||
|
Methylation in Case |
5.59E-02 (Median) | Methylation in Control | 4.09E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 3.97E-03; Z-score: 1.47E+00 | ||
|
Methylation in Case |
7.26E-02 (Median) | Methylation in Control | 5.71E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 4.54E-03; Z-score: 1.27E+00 | ||
|
Methylation in Case |
9.24E-02 (Median) | Methylation in Control | 7.14E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 9.90E-03; Z-score: 7.50E-01 | ||
|
Methylation in Case |
5.44E-02 (Median) | Methylation in Control | 4.26E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg09454187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.09E-02; Z-score: 2.93E-01 | ||
|
Methylation in Case |
8.59E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg18939241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.23E-02; Z-score: -8.73E-01 | ||
|
Methylation in Case |
7.11E-01 (Median) | Methylation in Control | 7.43E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 2.07E-02; Z-score: 7.64E-01 | ||
|
Methylation in Case |
6.23E-02 (Median) | Methylation in Control | 5.11E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 2.64E-02; Z-score: 4.26E-01 | ||
|
Methylation in Case |
5.37E-02 (Median) | Methylation in Control | 4.72E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg26519141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 3.96E-02; Z-score: 4.21E-01 | ||
|
Methylation in Case |
2.47E-01 (Median) | Methylation in Control | 2.25E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS200 (cg16389285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.08E+00 | Statistic Test | p-value: 3.15E-04; Z-score: 1.18E+00 | ||
|
Methylation in Case |
2.37E-02 (Median) | Methylation in Control | 1.14E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.77E+00 | Statistic Test | p-value: 6.46E-04; Z-score: 9.16E-01 | ||
|
Methylation in Case |
3.27E-02 (Median) | Methylation in Control | 1.84E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS200 (cg26230285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.22E+00 | Statistic Test | p-value: 7.01E-04; Z-score: 1.11E+00 | ||
|
Methylation in Case |
3.15E-02 (Median) | Methylation in Control | 1.42E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS200 (cg03419058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.57E+00 | Statistic Test | p-value: 1.99E-03; Z-score: 5.83E-01 | ||
|
Methylation in Case |
3.51E-02 (Median) | Methylation in Control | 2.23E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS200 (cg22113930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 1.17E-02; Z-score: 5.19E-01 | ||
|
Methylation in Case |
4.20E-02 (Median) | Methylation in Control | 3.44E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg25703338) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 5.72E-13; Z-score: 1.59E+00 | ||
|
Methylation in Case |
9.56E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg11442877) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.69E-12; Z-score: 1.67E+00 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 8.50E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg27323557) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 3.50E-10; Z-score: 1.43E+00 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.21E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.63E+00 | Statistic Test | p-value: 2.02E-09; Z-score: 2.96E+00 | ||
|
Methylation in Case |
5.64E-01 (Median) | Methylation in Control | 3.47E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg20049422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.54E+00 | Statistic Test | p-value: 7.60E-09; Z-score: 3.34E+00 | ||
|
Methylation in Case |
6.39E-01 (Median) | Methylation in Control | 4.15E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.56E+00 | Statistic Test | p-value: 1.87E-08; Z-score: 2.65E+00 | ||
|
Methylation in Case |
4.98E-01 (Median) | Methylation in Control | 3.19E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg04218022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.24E-08; Z-score: 1.17E+00 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg20119871) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 3.46E-08; Z-score: 1.32E+00 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 7.68E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg01364202) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 5.30E-08; Z-score: 9.61E-01 | ||
|
Methylation in Case |
9.36E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg20117103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.95E+00 | Statistic Test | p-value: 1.22E-07; Z-score: 3.34E+00 | ||
|
Methylation in Case |
3.36E-01 (Median) | Methylation in Control | 1.72E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg26478036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.87E-07; Z-score: 1.23E+00 | ||
|
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg12933431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.85E-07; Z-score: 2.02E+00 | ||
|
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg13361023) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 1.41E-06; Z-score: -1.77E+00 | ||
|
Methylation in Case |
5.04E-01 (Median) | Methylation in Control | 5.78E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg12582965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 5.95E-06; Z-score: 1.11E+00 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg02107240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.05E-05; Z-score: 1.23E+00 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg20696050) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 9.95E-05; Z-score: 8.83E-01 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg02208504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.30E-04; Z-score: 1.45E+00 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 7.70E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 3.04E-04; Z-score: 6.06E-01 | ||
|
Methylation in Case |
9.00E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg07986058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 3.11E-04; Z-score: -1.30E+00 | ||
|
Methylation in Case |
5.73E-01 (Median) | Methylation in Control | 6.67E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 8.75E-04; Z-score: -1.24E+00 | ||
|
Methylation in Case |
2.07E-01 (Median) | Methylation in Control | 2.70E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 1.15E-03; Z-score: 4.28E-01 | ||
|
Methylation in Case |
9.85E-01 (Median) | Methylation in Control | 9.81E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg17805836) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.43E-03; Z-score: 6.44E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.24E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg26336213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.90E-03; Z-score: 2.78E-01 | ||
|
Methylation in Case |
9.48E-01 (Median) | Methylation in Control | 9.43E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 41 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg01372572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 2.08E-03; Z-score: 1.27E+00 | ||
|
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 7.22E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 42 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg19930802) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 2.43E-03; Z-score: 2.22E-01 | ||
|
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 43 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.68E-03; Z-score: -1.06E+00 | ||
|
Methylation in Case |
8.69E-01 (Median) | Methylation in Control | 9.08E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 44 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 2.93E-03; Z-score: -1.04E+00 | ||
|
Methylation in Case |
6.69E-01 (Median) | Methylation in Control | 7.11E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 45 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg15338782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.97E-03; Z-score: -5.16E-01 | ||
|
Methylation in Case |
6.21E-01 (Median) | Methylation in Control | 6.66E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 46 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg01788205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 4.39E-03; Z-score: 3.68E-01 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 47 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg16397021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 6.70E-03; Z-score: 2.95E-01 | ||
|
Methylation in Case |
9.63E-01 (Median) | Methylation in Control | 9.49E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 48 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg16988989) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 7.01E-03; Z-score: 5.38E-01 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 49 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg15275965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.13E-02; Z-score: 7.90E-01 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 50 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg11557546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.66E-02; Z-score: -6.75E-01 | ||
|
Methylation in Case |
6.40E-01 (Median) | Methylation in Control | 6.68E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 51 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg10473100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 2.18E-02; Z-score: 2.99E-01 | ||
|
Methylation in Case |
9.95E-01 (Median) | Methylation in Control | 9.93E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 52 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg18749411) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 2.45E-02; Z-score: 3.91E-01 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 53 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg16395892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 3.80E-02; Z-score: 4.88E-01 | ||
|
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.38E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 54 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.18E-04; Z-score: 7.41E-01 | ||
|
Methylation in Case |
9.29E-01 (Median) | Methylation in Control | 9.14E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 55 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
3'UTR (cg04223222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 3.04E-03; Z-score: 6.80E-01 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
25 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg15523238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 6.62E-03; Z-score: 3.22E+00 | ||
|
Methylation in Case |
1.64E-01 (Median) | Methylation in Control | 1.20E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg18083248) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 7.60E-03; Z-score: 2.51E+00 | ||
|
Methylation in Case |
4.52E-01 (Median) | Methylation in Control | 3.23E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg17174275) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 7.87E-03; Z-score: -1.91E+00 | ||
|
Methylation in Case |
6.64E-01 (Median) | Methylation in Control | 7.23E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.58E+00 | Statistic Test | p-value: 1.58E-02; Z-score: 3.42E+00 | ||
|
Methylation in Case |
2.27E-01 (Median) | Methylation in Control | 1.43E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.68E+00 | Statistic Test | p-value: 3.98E-02; Z-score: 2.81E+00 | ||
|
Methylation in Case |
1.52E-01 (Median) | Methylation in Control | 9.00E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.19E-02; Z-score: -9.69E-01 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 4.46E-02; Z-score: 2.18E+00 | ||
|
Methylation in Case |
8.18E-02 (Median) | Methylation in Control | 6.51E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS200 (cg22113930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.09E+00 | Statistic Test | p-value: 6.20E-03; Z-score: 6.64E+00 | ||
|
Methylation in Case |
1.27E-01 (Median) | Methylation in Control | 6.08E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS200 (cg16389285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.54E+00 | Statistic Test | p-value: 9.28E-03; Z-score: 4.15E+00 | ||
|
Methylation in Case |
1.17E-01 (Median) | Methylation in Control | 4.61E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS200 (cg03419058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.84E+00 | Statistic Test | p-value: 9.89E-03; Z-score: 9.06E+00 | ||
|
Methylation in Case |
1.66E-01 (Median) | Methylation in Control | 5.86E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS200 (cg26230285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.08E+00 | Statistic Test | p-value: 1.28E-02; Z-score: 4.67E+00 | ||
|
Methylation in Case |
1.26E-01 (Median) | Methylation in Control | 6.03E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.77E+00 | Statistic Test | p-value: 1.35E-02; Z-score: 3.77E+00 | ||
|
Methylation in Case |
1.39E-01 (Median) | Methylation in Control | 5.02E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 3.20E-02; Z-score: 1.47E+00 | ||
|
Methylation in Case |
1.73E-01 (Median) | Methylation in Control | 1.39E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg15275965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 1.30E-03; Z-score: 2.49E+00 | ||
|
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 5.74E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg00602502) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 9.32E-03; Z-score: 2.05E+00 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg26913186) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.03E-02; Z-score: -1.25E+00 | ||
|
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg11442877) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.21E-02; Z-score: 1.30E+00 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg19326876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 1.52E-02; Z-score: 1.94E+00 | ||
|
Methylation in Case |
1.77E-01 (Median) | Methylation in Control | 1.26E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg07986058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.45E+00 | Statistic Test | p-value: 2.50E-02; Z-score: 2.76E+00 | ||
|
Methylation in Case |
4.09E-01 (Median) | Methylation in Control | 2.83E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg03924551) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 2.58E-02; Z-score: -2.20E+00 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 2.95E-02; Z-score: 1.02E+00 | ||
|
Methylation in Case |
6.28E-01 (Median) | Methylation in Control | 5.75E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 3.06E-02; Z-score: -2.43E+00 | ||
|
Methylation in Case |
6.88E-01 (Median) | Methylation in Control | 7.58E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg05626764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 4.42E-02; Z-score: 3.67E+00 | ||
|
Methylation in Case |
6.73E-02 (Median) | Methylation in Control | 5.32E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.91E-02; Z-score: -1.67E+00 | ||
|
Methylation in Case |
9.57E-01 (Median) | Methylation in Control | 9.69E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 5.16E-04; Z-score: 1.99E+00 | ||
|
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 9.80E-01 | Statistic Test | p-value: 2.54E-02; Z-score: 2.80E-01 | ||
|
Methylation in Case |
-5.36E+00 (Median) | Methylation in Control | -5.46E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg20049422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -8.01E-01 | Statistic Test | p-value: 2.09E-03; Z-score: -2.78E-01 | ||
|
Methylation in Case |
-9.53E-01 (Median) | Methylation in Control | -7.63E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg11557546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 1.52E-02; Z-score: 4.33E-01 | ||
|
Methylation in Case |
1.13E+00 (Median) | Methylation in Control | 9.78E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg07100560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.53E-02; Z-score: 2.77E-01 | ||
|
Methylation in Case |
2.79E+00 (Median) | Methylation in Control | 2.68E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg20117103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -9.13E-01 | Statistic Test | p-value: 2.02E-02; Z-score: -5.03E-01 | ||
|
Methylation in Case |
-3.44E+00 (Median) | Methylation in Control | -3.14E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -8.36E-01 | Statistic Test | p-value: 2.20E-02; Z-score: -5.49E-01 | ||
|
Methylation in Case |
-2.00E+00 (Median) | Methylation in Control | -1.67E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg26913186) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 2.80E-02; Z-score: 5.39E-01 | ||
|
Methylation in Case |
3.20E+00 (Median) | Methylation in Control | 2.95E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg02208504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.24E-02; Z-score: -1.59E-01 | ||
|
Methylation in Case |
1.51E+00 (Median) | Methylation in Control | 1.58E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg14216870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 4.46E-02; Z-score: 2.33E-01 | ||
|
Methylation in Case |
4.66E+00 (Median) | Methylation in Control | 4.60E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
21 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 9.06E-03; Z-score: -6.13E-01 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.27E-02; Z-score: 5.31E-01 | ||
|
Methylation in Case |
2.04E-01 (Median) | Methylation in Control | 1.80E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
TSS1500 (cg08828036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.98E-02; Z-score: 8.26E-01 | ||
|
Methylation in Case |
6.84E-01 (Median) | Methylation in Control | 6.45E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
TSS1500 (cg07470694) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.81E-02; Z-score: 7.37E-01 | ||
|
Methylation in Case |
8.56E-01 (Median) | Methylation in Control | 8.29E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg12860764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.27E+00 | Statistic Test | p-value: 1.21E-27; Z-score: -5.17E+00 | ||
|
Methylation in Case |
3.21E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg03924551) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.42E+00 | Statistic Test | p-value: 2.38E-16; Z-score: -5.40E+00 | ||
|
Methylation in Case |
5.97E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg15275965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 3.95E-12; Z-score: -3.70E+00 | ||
|
Methylation in Case |
6.47E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg02208504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 3.44E-07; Z-score: 1.61E+00 | ||
|
Methylation in Case |
8.12E-01 (Median) | Methylation in Control | 7.59E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg18256640) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 4.46E-06; Z-score: 1.16E+00 | ||
|
Methylation in Case |
9.19E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg27323557) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 7.32E-04; Z-score: -8.05E-01 | ||
|
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.54E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg07100560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 9.69E-04; Z-score: -6.52E-01 | ||
|
Methylation in Case |
9.43E-01 (Median) | Methylation in Control | 9.51E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg12933431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 2.60E-03; Z-score: 1.55E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 6.91E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 8.42E-03; Z-score: -7.68E-01 | ||
|
Methylation in Case |
4.21E-01 (Median) | Methylation in Control | 4.70E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg11817038) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.16E-02; Z-score: -3.26E-01 | ||
|
Methylation in Case |
8.98E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg16397021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.37E-02; Z-score: 1.40E+00 | ||
|
Methylation in Case |
8.93E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg16988989) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.39E-02; Z-score: -6.30E-01 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.26E-02; Z-score: 3.76E-01 | ||
|
Methylation in Case |
6.33E-01 (Median) | Methylation in Control | 6.15E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg07986058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 2.36E-02; Z-score: -8.11E-01 | ||
|
Methylation in Case |
4.49E-01 (Median) | Methylation in Control | 5.19E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg07489029) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.64E-02; Z-score: 7.44E-01 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.10E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg17864405) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 2.79E-02; Z-score: 1.63E-01 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 3.99E-02; Z-score: 5.74E-01 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
TSS1500 (cg08599496) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.69E-02; Z-score: 1.71E+00 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 8.80E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
TSS1500 (cg04361126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 2.85E-02; Z-score: 1.67E+00 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 6.97E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
TSS1500 (cg05851042) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 3.18E-02; Z-score: 2.75E+00 | ||
|
Methylation in Case |
9.44E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
TSS1500 (cg16848712) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 3.76E-02; Z-score: 3.01E+00 | ||
|
Methylation in Case |
7.19E-01 (Median) | Methylation in Control | 5.78E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
TSS200 (cg21331335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.55E-02; Z-score: 1.98E+00 | ||
|
Methylation in Case |
9.70E-01 (Median) | Methylation in Control | 9.46E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
TSS200 (cg20947082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.67E+00 | Statistic Test | p-value: 2.48E-02; Z-score: 2.39E+00 | ||
|
Methylation in Case |
9.96E-02 (Median) | Methylation in Control | 5.98E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
Body (cg10620395) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.36E-03; Z-score: 3.76E+00 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
Body (cg24984698) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 3.24E-02; Z-score: -1.77E+01 | ||
|
Methylation in Case |
6.57E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
Body (cg21150675) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 3.85E-02; Z-score: 1.43E+00 | ||
|
Methylation in Case |
9.57E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
Body (cg12516187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 4.72E-02; Z-score: 1.42E+00 | ||
|
Methylation in Case |
8.49E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
29 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg16417876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.16E-04; Z-score: -3.40E-01 | ||
|
Methylation in Case |
8.77E-01 (Median) | Methylation in Control | 8.88E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg00774088) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 9.30E-04; Z-score: -4.09E-01 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.36E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg24687432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.04E-03; Z-score: -2.93E-01 | ||
|
Methylation in Case |
7.69E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.83E-03; Z-score: -1.67E-01 | ||
|
Methylation in Case |
7.08E-02 (Median) | Methylation in Control | 7.50E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 2.15E-03; Z-score: -1.63E-01 | ||
|
Methylation in Case |
7.52E-02 (Median) | Methylation in Control | 7.96E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg26879349) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.84E-03; Z-score: -1.24E-01 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 9.12E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg08828036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.91E-03; Z-score: -3.35E-01 | ||
|
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 7.71E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 8.42E-03; Z-score: -1.18E-01 | ||
|
Methylation in Case |
8.02E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.09E-02; Z-score: -1.64E-01 | ||
|
Methylation in Case |
5.85E-02 (Median) | Methylation in Control | 6.23E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.19E-02; Z-score: -1.11E-01 | ||
|
Methylation in Case |
7.08E-02 (Median) | Methylation in Control | 7.33E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg26062856) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.98E-02; Z-score: -1.55E-01 | ||
|
Methylation in Case |
6.91E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.33E-02; Z-score: -6.08E-02 | ||
|
Methylation in Case |
4.85E-02 (Median) | Methylation in Control | 4.93E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg09454187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 2.37E-02; Z-score: -4.07E-02 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg07470694) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.44E-02; Z-score: -1.13E-01 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 9.12E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.50E-02; Z-score: -5.06E-02 | ||
|
Methylation in Case |
3.94E-02 (Median) | Methylation in Control | 4.01E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 8.77E-03; Z-score: -1.35E-01 | ||
|
Methylation in Case |
1.46E-01 (Median) | Methylation in Control | 1.50E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 2.08E-12; Z-score: -5.33E-01 | ||
|
Methylation in Case |
2.44E-01 (Median) | Methylation in Control | 2.87E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg15338782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 5.95E-05; Z-score: -4.80E-01 | ||
|
Methylation in Case |
5.87E-01 (Median) | Methylation in Control | 6.37E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg19326876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.91E-04; Z-score: -1.06E-01 | ||
|
Methylation in Case |
9.54E-02 (Median) | Methylation in Control | 9.88E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg26478036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 2.35E-03; Z-score: 1.35E-01 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg14001035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 3.09E-03; Z-score: 2.09E-01 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg20117103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 8.84E-03; Z-score: 1.37E-01 | ||
|
Methylation in Case |
2.93E-01 (Median) | Methylation in Control | 2.66E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg01206944) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.39E-02; Z-score: 2.13E-01 | ||
|
Methylation in Case |
6.94E-01 (Median) | Methylation in Control | 6.77E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg26336213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 2.43E-02; Z-score: 9.00E-02 | ||
|
Methylation in Case |
9.38E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg16727862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 2.46E-02; Z-score: 7.86E-02 | ||
|
Methylation in Case |
1.64E-01 (Median) | Methylation in Control | 1.63E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg19657603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.59E-02; Z-score: -1.06E-01 | ||
|
Methylation in Case |
5.46E-02 (Median) | Methylation in Control | 5.58E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 2.78E-02; Z-score: -2.33E-01 | ||
|
Methylation in Case |
9.75E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg01372572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 4.19E-02; Z-score: 2.71E-01 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 7.56E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 4.64E-02; Z-score: 1.82E-01 | ||
|
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
40 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.18E+00 | Statistic Test | p-value: 8.48E-18; Z-score: 3.35E+00 | ||
|
Methylation in Case |
4.30E-01 (Median) | Methylation in Control | 1.97E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg00602502) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 3.03E-05; Z-score: 1.09E+00 | ||
|
Methylation in Case |
8.22E-01 (Median) | Methylation in Control | 7.06E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg01206944) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 5.52E-05; Z-score: -1.07E+00 | ||
|
Methylation in Case |
8.72E-01 (Median) | Methylation in Control | 9.09E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg01364202) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.90E+00 | Statistic Test | p-value: 6.21E-05; Z-score: -1.22E+00 | ||
|
Methylation in Case |
2.98E-01 (Median) | Methylation in Control | 5.67E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg01372572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.21E+00 | Statistic Test | p-value: 6.29E-05; Z-score: 1.36E+00 | ||
|
Methylation in Case |
5.34E-01 (Median) | Methylation in Control | 2.42E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg01788205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 8.33E-05; Z-score: 5.05E-01 | ||
|
Methylation in Case |
2.52E-01 (Median) | Methylation in Control | 2.04E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg02107240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 1.16E-04; Z-score: 9.18E-01 | ||
|
Methylation in Case |
8.80E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg02208504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.22E-04; Z-score: -9.31E-01 | ||
|
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 8.88E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg02287939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 1.39E-04; Z-score: 6.76E-01 | ||
|
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 7.35E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 1.48E-04; Z-score: -1.32E+00 | ||
|
Methylation in Case |
6.48E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg02747151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.25E-04; Z-score: -7.05E-01 | ||
|
Methylation in Case |
6.33E-01 (Median) | Methylation in Control | 6.85E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg03924551) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 5.02E-04; Z-score: -1.07E+00 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg04218022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 6.27E-04; Z-score: -4.21E-01 | ||
|
Methylation in Case |
8.12E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg05626764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.57E-03; Z-score: -5.46E-01 | ||
|
Methylation in Case |
6.50E-01 (Median) | Methylation in Control | 7.09E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.02E-03; Z-score: -5.17E-01 | ||
|
Methylation in Case |
9.15E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg07100560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 3.30E-03; Z-score: 5.28E-01 | ||
|
Methylation in Case |
3.50E-01 (Median) | Methylation in Control | 3.14E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg07318335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 3.79E-03; Z-score: 5.37E-01 | ||
|
Methylation in Case |
1.45E-01 (Median) | Methylation in Control | 1.06E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg07489029) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 4.00E-03; Z-score: 8.62E-01 | ||
|
Methylation in Case |
8.91E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg07986058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 5.11E-03; Z-score: 6.91E-01 | ||
|
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.40E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg08831522) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 8.11E-03; Z-score: 5.42E-01 | ||
|
Methylation in Case |
1.96E-01 (Median) | Methylation in Control | 1.56E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.26E-02; Z-score: -4.10E-01 | ||
|
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 7.82E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg09978546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.28E-02; Z-score: 5.68E-01 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg10473100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.49E+00 | Statistic Test | p-value: 1.49E-02; Z-score: -5.47E-01 | ||
|
Methylation in Case |
1.00E-01 (Median) | Methylation in Control | 1.49E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 1.75E-02; Z-score: 4.42E-01 | ||
|
Methylation in Case |
1.72E-01 (Median) | Methylation in Control | 1.48E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg11015241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 1.98E-02; Z-score: 4.28E-01 | ||
|
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 6.69E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg11442877) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 2.25E-02; Z-score: -2.26E-01 | ||
|
Methylation in Case |
2.89E-02 (Median) | Methylation in Control | 3.62E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 27 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg11557546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.30E-02; Z-score: 5.04E-01 | ||
|
Methylation in Case |
9.17E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 28 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg11817038) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 2.52E-02; Z-score: 6.77E-01 | ||
|
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 7.20E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 29 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg12582965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.84E-02; Z-score: 3.79E-01 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 30 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg12860764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 3.06E-02; Z-score: -6.67E-01 | ||
|
Methylation in Case |
2.72E-01 (Median) | Methylation in Control | 3.10E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 31 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg12933431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 3.17E-02; Z-score: 4.25E-01 | ||
|
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.39E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 32 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg13060434) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 3.23E-02; Z-score: 6.44E-01 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 33 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 3.49E-02; Z-score: 3.95E-01 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 34 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg13361023) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 3.53E-02; Z-score: 5.95E-01 | ||
|
Methylation in Case |
8.41E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 35 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 3.65E-02; Z-score: 3.44E-01 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 36 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg13825334) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.90E-02; Z-score: -1.48E-01 | ||
|
Methylation in Case |
7.85E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 37 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg14001035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 4.09E-02; Z-score: 8.80E-02 | ||
|
Methylation in Case |
1.38E-01 (Median) | Methylation in Control | 1.36E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 38 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg14216870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 4.32E-02; Z-score: -6.34E-01 | ||
|
Methylation in Case |
1.27E-01 (Median) | Methylation in Control | 1.73E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 39 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 1.50E-14; Z-score: -2.88E+00 | ||
|
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 8.94E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 40 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
3'UTR (cg04223222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.79E+00 | Statistic Test | p-value: 2.59E-14; Z-score: 2.59E+00 | ||
|
Methylation in Case |
5.41E-01 (Median) | Methylation in Control | 1.94E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of ATP10A in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.10E-26; Fold-change: 0.486364439; Z-score: 8.669483283 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypermethylation of ATP10A in gastric cancer than that in adjacent tissue | ||||
Studied Phenotype |
Gastric cancer [ICD-11:2B72] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value: 4.32E-18; Fold-change: 0.229351566; Z-score: 19.96382269 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
microRNA |
|||||
|
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-335 directly targets ATP10A | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
|
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.