Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0537 Transporter Info
Gene Name RALBP1
Transporter Name RalBP1-associated Eps domain-containing protein 2
Gene ID
10928
UniProt ID
Q8NFH8
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg03236570)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.41E-08; Z-score: -1.06E+00

Methylation in Case

 8.23E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of RALBP1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg05121812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 4.42E-08; Z-score: 1.67E+00

Methylation in Case

 9.07E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of RALBP1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg12907513)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 4.06E-07; Z-score: 8.35E-01

Methylation in Case

 8.84E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of RALBP1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg15947599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.50E+00 Statistic Test p-value: 1.61E-06; Z-score: 9.42E-01

Methylation in Case

 2.30E-01 (Median) Methylation in Control 1.53E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of RALBP1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg19013594)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.44E+00 Statistic Test p-value: 2.69E-06; Z-score: -1.13E+00

Methylation in Case

 4.64E-01 (Median) Methylation in Control 6.67E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of RALBP1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg21200923)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 4.98E-06; Z-score: -8.00E-01

Methylation in Case

 8.73E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of RALBP1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg13272780)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 2.55E-11; Z-score: -1.76E+00

Methylation in Case

 8.36E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in bladder cancer [ 2 ]

Location

 5'UTR (cg05121812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 2.22E-06; Z-score: -6.21E+00

Methylation in Case

 7.71E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of RALBP1 in bladder cancer [ 2 ]

Location

 5'UTR (cg21200923)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.66E-02; Z-score: -9.65E-01

Methylation in Case

 7.98E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of RALBP1 in bladder cancer [ 2 ]

Location

 5'UTR (cg12907513)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.83E-02; Z-score: -2.55E+00

Methylation in Case

 8.93E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of RALBP1 in bladder cancer [ 2 ]

Location

 TSS1500 (cg21923525)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.68E+00 Statistic Test p-value: 1.60E-10; Z-score: -1.36E+01

Methylation in Case

 4.18E-01 (Median) Methylation in Control 7.04E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of RALBP1 in bladder cancer [ 2 ]

Location

 TSS1500 (cg13993179)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.43E+00 Statistic Test p-value: 1.32E-06; Z-score: -9.51E+00

Methylation in Case

 5.60E-01 (Median) Methylation in Control 8.01E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of RALBP1 in bladder cancer [ 2 ]

Location

 TSS1500 (cg15982419)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 3.05E-02; Z-score: -2.69E+00

Methylation in Case

 1.78E-01 (Median) Methylation in Control 2.35E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of RALBP1 in bladder cancer [ 2 ]

Location

 TSS200 (cg06753227)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 5.80E-05; Z-score: -3.60E+00

Methylation in Case

 4.58E-01 (Median) Methylation in Control 4.88E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of RALBP1 in bladder cancer [ 2 ]

Location

 Body (cg16300329)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 6.73E-03; Z-score: 1.36E+00

Methylation in Case

 6.46E-01 (Median) Methylation in Control 5.78E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of RALBP1 in bladder cancer [ 2 ]

Location

 3'UTR (cg13272780)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 7.00E-06; Z-score: -5.06E+00

Methylation in Case

 8.15E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in breast cancer [ 3 ]

Location

 5'UTR (cg05121812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 3.95E-05; Z-score: 1.18E+00

Methylation in Case

 8.49E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of RALBP1 in breast cancer [ 3 ]

Location

 TSS1500 (cg15982419)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.73E+00 Statistic Test p-value: 3.38E-16; Z-score: 3.76E+00

Methylation in Case

 3.51E-01 (Median) Methylation in Control 2.02E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of RALBP1 in breast cancer [ 3 ]

Location

 TSS200 (cg22466830)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 1.05E-02; Z-score: 5.61E-01

Methylation in Case

 1.50E-02 (Median) Methylation in Control 1.19E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of RALBP1 in breast cancer [ 3 ]

Location

 TSS200 (cg05854894)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 2.73E-02; Z-score: -4.79E-01

Methylation in Case

 1.04E-02 (Median) Methylation in Control 1.37E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of RALBP1 in breast cancer [ 3 ]

Location

 Body (cg16300329)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.27E+00 Statistic Test p-value: 3.49E-23; Z-score: 3.45E+00

Methylation in Case

 7.20E-01 (Median) Methylation in Control 5.67E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of RALBP1 in breast cancer [ 3 ]

Location

 3'UTR (cg13272780)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.24E-04; Z-score: -8.41E-01

Methylation in Case

 8.55E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg05121812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 7.33E-05; Z-score: 1.62E+00

Methylation in Case

 9.50E-01 (Median) Methylation in Control 9.31E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of RALBP1 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg15982419)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.63E+00 Statistic Test p-value: 6.37E-07; Z-score: 1.99E+00

Methylation in Case

 3.38E-01 (Median) Methylation in Control 2.08E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of RALBP1 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg13993179)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 2.12E-03; Z-score: 2.36E+00

Methylation in Case

 9.17E-01 (Median) Methylation in Control 8.02E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of RALBP1 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg22466830)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 4.41E-03; Z-score: 4.66E-01

Methylation in Case

 1.66E-02 (Median) Methylation in Control 1.58E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg05121812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 3.16E-02; Z-score: 2.92E-02

Methylation in Case

 8.52E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of RALBP1 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg15982419)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 3.95E-06; Z-score: 2.01E+00

Methylation in Case

 4.93E-01 (Median) Methylation in Control 4.08E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of RALBP1 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg21923525)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.87E-03; Z-score: -1.00E+00

Methylation in Case

 6.59E-01 (Median) Methylation in Control 7.01E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of RALBP1 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg06753227)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.48E-02; Z-score: -2.24E-01

Methylation in Case

 4.01E-01 (Median) Methylation in Control 4.09E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of RALBP1 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg22359828)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.04E+00 Statistic Test p-value: 5.71E-21; Z-score: -3.89E+00

Methylation in Case

 2.12E-01 (Median) Methylation in Control 4.33E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of RALBP1 in hepatocellular carcinoma [ 5 ]

Location

 3'UTR (cg13272780)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 9.40E-03; Z-score: -4.23E-01

Methylation in Case

 8.63E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in HIV infection [ 6 ]

Location

 5'UTR (cg12907513)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.26E-02; Z-score: -4.50E-01

Methylation in Case

 9.14E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of RALBP1 in HIV infection [ 6 ]

Location

 TSS1500 (cg21923525)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.67E+00 Statistic Test p-value: 1.71E-08; Z-score: 4.39E+00

Methylation in Case

 5.66E-01 (Median) Methylation in Control 3.40E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of RALBP1 in HIV infection [ 6 ]

Location

 TSS1500 (cg15982419)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 2.16E-05; Z-score: 1.62E+00

Methylation in Case

 5.51E-01 (Median) Methylation in Control 4.47E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of RALBP1 in HIV infection [ 6 ]

Location

 TSS1500 (cg18989081)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.27E+00 Statistic Test p-value: 6.98E-04; Z-score: 1.34E+00

Methylation in Case

 1.20E-01 (Median) Methylation in Control 9.42E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of RALBP1 in HIV infection [ 6 ]

Location

 TSS1500 (cg13993179)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 4.72E-02; Z-score: 1.28E-01

Methylation in Case

 8.58E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of RALBP1 in HIV infection [ 6 ]

Location

 Body (cg16300329)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.18E-03; Z-score: -8.57E-01

Methylation in Case

 9.56E-01 (Median) Methylation in Control 9.66E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in prostate cancer [ 7 ]

Location

 5'UTR (cg10829727)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.24E+00 Statistic Test p-value: 2.76E-03; Z-score: 3.74E+01

Methylation in Case

 5.10E-01 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of RALBP1 in prostate cancer [ 7 ]

Location

 Body (cg21522289)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 7.17E-03; Z-score: 2.68E+00

Methylation in Case

 9.21E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in colorectal cancer [ 8 ]

Location

 TSS1500 (cg21923525)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 1.69E-12; Z-score: -3.64E+00

Methylation in Case

 7.08E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of RALBP1 in colorectal cancer [ 8 ]

Location

 TSS200 (cg12799349)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 2.34E-05; Z-score: 1.07E+00

Methylation in Case

 7.83E-02 (Median) Methylation in Control 6.86E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of RALBP1 in colorectal cancer [ 8 ]

Location

 TSS200 (cg22466830)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.37E+00 Statistic Test p-value: 2.96E-03; Z-score: 1.19E+00

Methylation in Case

 1.56E-02 (Median) Methylation in Control 1.14E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of RALBP1 in colorectal cancer [ 8 ]

Location

 TSS200 (cg06753227)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 4.80E-03; Z-score: 7.03E-01

Methylation in Case

 3.98E-01 (Median) Methylation in Control 3.54E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of RALBP1 in colorectal cancer [ 8 ]

Location

 TSS200 (cg09664812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 2.72E-02; Z-score: 4.78E-01

Methylation in Case

 1.07E-01 (Median) Methylation in Control 9.77E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of RALBP1 in colorectal cancer [ 8 ]

Location

 Body (cg16300329)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 9.96E-03; Z-score: -9.62E-01

Methylation in Case

 8.08E-01 (Median) Methylation in Control 9.17E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in lung adenocarcinoma [ 9 ]

Location

 TSS1500 (cg15982419)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 1.95E-03; Z-score: 2.32E+00

Methylation in Case

 5.33E-01 (Median) Methylation in Control 4.37E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in pancretic ductal adenocarcinoma [ 10 ]

Location

 TSS1500 (cg03307893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.92E+00 Statistic Test p-value: 7.88E-06; Z-score: 1.77E+00

Methylation in Case

 3.28E-01 (Median) Methylation in Control 8.38E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of RALBP1 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg12106894)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.05E-07; Z-score: -1.14E+00

Methylation in Case

 8.86E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of RALBP1 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg01316792)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 2.16E-03; Z-score: 1.40E+00

Methylation in Case

 8.24E-01 (Median) Methylation in Control 7.99E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of RALBP1 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg24045078)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.06E-02; Z-score: -1.23E-01

Methylation in Case

 8.29E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in panic disorder [ 11 ]

Location

 TSS1500 (cg21923525)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -9.01E-01 Statistic Test p-value: 1.59E-02; Z-score: -3.56E-01

Methylation in Case

 -1.55E+00 (Median) Methylation in Control -1.39E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of RALBP1 in panic disorder [ 11 ]

Location

 TSS1500 (cg15982419)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -6.95E-01 Statistic Test p-value: 4.04E-02; Z-score: -3.36E-01

Methylation in Case

 -7.52E-01 (Median) Methylation in Control -5.22E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in papillary thyroid cancer [ 12 ]

Location

 TSS1500 (cg13993179)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 7.96E-04; Z-score: 1.34E+00

Methylation in Case

 8.86E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of RALBP1 in papillary thyroid cancer [ 12 ]

Location

 3'UTR (cg13272780)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.28E-03; Z-score: -5.25E-01

Methylation in Case

 9.00E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in systemic lupus erythematosus [ 13 ]

Location

 TSS1500 (cg13993179)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.93E-04; Z-score: -3.59E-01

Methylation in Case

 8.80E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Colon cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of RALBP1 in colon adenocarcinoma [ 14 ]

Location

 TSS200 (cg04299028)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 3.77E-04; Z-score: -2.58E+00

Methylation in Case

 6.71E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of RALBP1 in colon adenocarcinoma [ 14 ]

Location

 Body (cg18426477)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.36E+00 Statistic Test p-value: 1.02E-06; Z-score: -4.46E+00

Methylation in Case

 4.27E-01 (Median) Methylation in Control 5.81E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of RALBP1 in colon adenocarcinoma [ 14 ]

Location

 Body (cg04437482)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 6.90E-04; Z-score: -3.25E+00

Methylation in Case

 6.23E-01 (Median) Methylation in Control 7.01E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of RALBP1 in colon adenocarcinoma [ 14 ]

Location

 3'UTR (cg18377941)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 2.71E-05; Z-score: -2.61E+00

Methylation in Case

 5.82E-01 (Median) Methylation in Control 7.48E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          23 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-10a directly targets RALBP1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-10a miRNA Mature ID miR-10a-5p

miRNA Sequence

 UACCCUGUAGAUCCGAAUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-10b directly targets RALBP1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-10b miRNA Mature ID miR-10b-5p

miRNA Sequence

 UACCCUGUAGAACCGAAUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-125a directly targets RALBP1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-125a miRNA Mature ID miR-125a-5p

miRNA Sequence

 UCCCUGAGACCCUUUAACCUGUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-185 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-185 miRNA Mature ID miR-185-5p

miRNA Sequence

 UGGAGAGAAAGGCAGUUCCUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-1914 directly targets RALBP1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-1914 miRNA Mature ID miR-1914-5p

miRNA Sequence

 CCCUGUGCCCGGCCCACUUCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-298 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-298 miRNA Mature ID miR-298

miRNA Sequence

 AGCAGAAGCAGGGAGGUUCUCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-3158 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3158 miRNA Mature ID miR-3158-5p

miRNA Sequence

 CCUGCAGAGAGGAAGCCCUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-4306 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4306 miRNA Mature ID miR-4306

miRNA Sequence

 UGGAGAGAAAGGCAGUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-4418 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4418 miRNA Mature ID miR-4418

miRNA Sequence

 CACUGCAGGACUCAGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-4428 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4428 miRNA Mature ID miR-4428

miRNA Sequence

 CAAGGAGACGGGAACAUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-4481 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4481 miRNA Mature ID miR-4481

miRNA Sequence

 GGAGUGGGCUGGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-4640 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4640 miRNA Mature ID miR-4640-5p

miRNA Sequence

 UGGGCCAGGGAGCAGCUGGUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-4644 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4644 miRNA Mature ID miR-4644

miRNA Sequence

 UGGAGAGAGAAAAGAGACAGAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-4693 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4693 miRNA Mature ID miR-4693-3p

miRNA Sequence

 UGAGAGUGGAAUUCACAGUAUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-4726 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4726 miRNA Mature ID miR-4726-5p

miRNA Sequence

 AGGGCCAGAGGAGCCUGGAGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-4745 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4745 miRNA Mature ID miR-4745-5p

miRNA Sequence

 UGAGUGGGGCUCCCGGGACGGCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-4784 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4784 miRNA Mature ID miR-4784

miRNA Sequence

 UGAGGAGAUGCUGGGACUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-509 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-509 miRNA Mature ID miR-509-5p

miRNA Sequence

 UACUGCAGACAGUGGCAAUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-5192 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5192 miRNA Mature ID miR-5192

miRNA Sequence

 AGGAGAGUGGAUUCCAGGUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-615 directly targets RALBP1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-615 miRNA Mature ID miR-615-3p

miRNA Sequence

 UCCGAGCCUGGGUCUCCCUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 21

 miR-6508 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6508 miRNA Mature ID miR-6508-3p

miRNA Sequence

 UGGGCCAUGCAUUUCUAGAACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-6758 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6758 miRNA Mature ID miR-6758-5p

miRNA Sequence

 UAGAGAGGGGAAGGAUGUGAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-6856 directly targets RALBP1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6856 miRNA Mature ID miR-6856-5p

miRNA Sequence

 AAGAGAGGAGCAGUGGUGCUGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
8 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
15 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
16 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.