Detail Information of Genetic Polymorphisms
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0455 Transporter Info | ||||
| Gene Name | SLC6A3 | ||||
| Protein Name | Sodium-dependent dopamine transporter | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Genetic Polymorphisms of DT (GPD) | |||||
| Genetic Polymorphism | rs2975226 | ||||
| Site of GPD | chr5:1445501 (GRCh38.p12) | ||||
| GPD Type | SNP | ||||
| Allele(s) in dbSNP | A>T | ||||
| Minor Allele Frequency | T=0.3710/1858 (Global) | ||||
| Allele A | Click to Show/Hide the Full List of Affected Drugs: 1 Drugs in Total | ||||
| Clozapine | Drug Info | Schizophrenia | Correlated with the increased drug response in patients (compare with Allele T) | [ 1] | |
| Genetic Polymorphism | rs3836790 | ||||
| Site of GPD | chr5:1411740-1411741 (GRCh38.p12) | ||||
| GPD Type | InsertionI | ||||
| Allele(s) in dbSNP | insACAT(AC)3TCAG(AC)3ATACCATGCA | ||||
| Genotype CACATACCATGCAACATACACACTCAGACA/CACATACCATGCAACATACACACTCAGACA | Click to Show/Hide the Full List of Affected Drugs: 2 Drugs in Total | ||||
| Levodopa | Drug Info | Parkinson Disease | Correlated with the increased drug response in patients (compare with genotypes CACAtACCAtGCAACAtACACACtCAGACA/del + del/del) | [ 2] | |
| Methylphenidate | Drug Info | Parkinson Disease | Correlated with the increased drug response in patients (compare with genotypes CACAtACCAtGCAACAtACACACtCAGACA/del + del/del) | [ 2] | |
| Genetic Polymorphism | rs6350 | ||||
| Site of GPD | chr5:1443084 (GRCh38.p12) | ||||
| GPD Type | SNP | ||||
| Allele(s) in dbSNP | G>A / G>C | ||||
| Minor Allele Frequency | A=0.0455/228 (Global) | ||||
| Genotype AG | Click to Show/Hide the Full List of Affected Drugs: 1 Drugs in Total | ||||
| Ethanol | Drug Info | Intractable Chronic Pain; Cystitis | Correlated with the increased alcoholism risk in patients (compare with genotype GG) | [ 3] | |
| References | |||||
| 1 | Pharacogenetic effects of dopamine transporter gene polymorphisms on response to chlorpromazine and clozapine and on extrapyramidal syndrome in schizophrenia. Prog Neuropsychopharmacol Biol Psychiatry. 2010 Aug 16;34(6):1026-32. | ||||
| 2 | Polymorphism of the dopamine transporter type 1 gene modifies the treatment response in Parkinson's disease. Brain. 2015 May;138(Pt 5):1271-83. | ||||
| 3 | The SLC6A3 gene possibly affects susceptibility to late-onset alcohol dependence but not specific personality traits in a Han Chinese population. PLoS One. 2017 Feb 9;12(2):e0171170. | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.