Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0010 Transporter Info
Gene Name SLC22A1
Transporter Name Organic cation transporter 1
Gene ID
6580
UniProt ID
O15245
Epigenetic Regulations of This DT (EGR)

Methylation

  Bile duct carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of SLC22A1 in Bile duct carcinoma (compare with non-tumor adjacent tissue) [ 1 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Related Molecular Changes

 Down regulation of SLC22A1 Experiment Method Immunofluorescence and Immunoblotting Assays

Studied Phenotype

 Bile duct carcinoma [ ICD-11: 2C12.1]

Experimental Material

 Lentiviral-mediated transduction of eCCA (EGI-1 and TFK-1) and iCCA (HuCCT1) cells

Additional Notes

 DNA Hypermethylation of individual CpG sites within the SLC22A1 gene is associated with downregulation of SLC22A1 expression in bile duct carcinoma.

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of SLC22A1 in hepatocellular carcinoma (compare with non-tumor adjacent tissue) [ 2 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method MALDI-TOF MS

Related Molecular Changes

 Down regulation of SLC22A1 Experiment Method Western Blot

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

Additional Notes

 DNA Hypermethylation of individual CpG sites within the SLC22A1 gene is associated with downregulation of SLC22A1 expression in HCC.

  Epigenetic Phenomenon 2

 Hypermethylation of SLC22A1 in hepatocellular carcinoma (compare with non-tumor adjacent tissue) [ 3 ]

Location

 Promoter (cg13434757, cg27292431)

Epigenetic Type

 Methylation Experiment Method HumanMethylation450 BeadChip

Related Molecular Changes

 Down regulation of SLC22A1 Experiment Method RT-qPCR

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

Additional Notes

 OCT1 expression was inversely correlated with SLC22A1 promoter methylation in hepatocellular, whereas demethylation with decitabine enhanced hOCT1 expression in hepatoma cells.

  Diabetes

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of SLC22A1 in diabetes [ 4 ]

Location

 Promoter (4 CpG sites)

Epigenetic Type

 Methylation Experiment Method HumanMethylation450 BeadChip

Studied Phenotype

 Diabetes [ ICD-11: 5A10-5A14]

Experimental Material

 Patient tissue samples

Additional Notes

 Metformin treatment directly decreased DNA methylation of SLC22A1 in hepatocytes cultured in vitro.

microRNA

  Unclear Phenotype

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-3941 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

 UUACACACAACUGAGGAUCAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-4275 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4275 miRNA Mature ID miR-4275

miRNA Sequence

 CCAAUUACCACUUCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-466 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-466 miRNA Mature ID miR-466

miRNA Sequence

 AUACACAUACACGCAACACACAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-4672 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4672 miRNA Mature ID miR-4672

miRNA Sequence

 UUACACAGCUGGACAGAGGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-4687 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4687 miRNA Mature ID miR-4687-5p

miRNA Sequence

 CAGCCCUCCUCCCGCACCCAAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-6768 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6768 miRNA Mature ID miR-6768-5p

miRNA Sequence

 CACACAGGAAAAGCGGGGCCCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-6856 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6856 miRNA Mature ID miR-6856-3p

miRNA Sequence

 UACAGCCCUGUGAUCUUUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Perceived parental guan and school adjustment among Chinese early adolescents: The moderating role of interdependent self-construal. J Adolesc. 2019 Feb;71:18-27.
2 DNA methylation is associated with downregulation of the organic cation transporter OCT1 (SLC22A1) in human hepatocellular carcinoma. Genome Med. 2011 Dec 23;3(12):82.
3 Epigenetic events involved in organic cation transporter 1-dependent impaired response of hepatocellular carcinoma to sorafenib. Br J Pharmacol. 2019 Mar;176(6):787-800.
4 Diabetes medication associates with DNA methylation of metformin transporter genes in the human liver. Clin Epigenetics. 2017 Sep 21;9:102.
5 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.