Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0125 Transporter Info | ||||
| Gene Name | SLC18B1 | ||||
| Transporter Name | MFS-type transporter SLC18B1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-1207 directly targets SLC18B1 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1207 | miRNA Mature ID | miR-1207-5p | ||
|
miRNA Sequence |
UGGCAGGGAGGCUGGGAGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 2 |
miR-183 directly targets SLC18B1 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-183 | miRNA Mature ID | miR-183-5p | ||
|
miRNA Sequence |
UAUGGCACUGGUAGAAUUCACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 3 |
miR-193b directly targets SLC18B1 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-193b | miRNA Mature ID | miR-193b-3p | ||
|
miRNA Sequence |
AACUGGCCCUCAAAGUCCCGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 4 |
miR-31 directly targets SLC18B1 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-31 | miRNA Mature ID | miR-31-5p | ||
|
miRNA Sequence |
AGGCAAGAUGCUGGCAUAGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 5 |
miR-4736 directly targets SLC18B1 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4736 | miRNA Mature ID | miR-4736 | ||
|
miRNA Sequence |
AGGCAGGUUAUCUGGGCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 6 |
miR-4742 directly targets SLC18B1 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4742 | miRNA Mature ID | miR-4742-5p | ||
|
miRNA Sequence |
UCAGGCAAAGGGAUAUUUACAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 7 |
miR-4763 directly targets SLC18B1 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4763 | miRNA Mature ID | miR-4763-3p | ||
|
miRNA Sequence |
AGGCAGGGGCUGGUGCUGGGCGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 8 |
miR-6875 directly targets SLC18B1 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6875 | miRNA Mature ID | miR-6875-3p | ||
|
miRNA Sequence |
AUUCUUCCUGCCCUGGCUCCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 9 |
miR-7150 directly targets SLC18B1 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7150 | miRNA Mature ID | miR-7150 | ||
|
miRNA Sequence |
CUGGCAGGGGGAGAGGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.