Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0241 Transporter Info
Gene Name SLC27A4
Transporter Name Long-chain fatty acid transport protein 4
Gene ID
10999
UniProt ID
Q6P1M0
Epigenetic Regulations of This DT (EGR)

Methylation

  Breast cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC27A4 in breast cancer [ 1 ]

Location

 5'UTR (cg14257319)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 9.43E-03; Z-score: 4.45E-01

Methylation in Case

 8.48E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC27A4 in breast cancer [ 1 ]

Location

 TSS1500 (cg13588599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 2.17E-08; Z-score: -1.70E+00

Methylation in Case

 3.56E-01 (Median) Methylation in Control 4.71E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC27A4 in breast cancer [ 1 ]

Location

 Body (cg14359934)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 2.01E-04; Z-score: 1.16E+00

Methylation in Case

 7.76E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC27A4 in breast cancer [ 1 ]

Location

 Body (cg14128173)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.99E-04; Z-score: 6.45E-01

Methylation in Case

 9.36E-01 (Median) Methylation in Control 9.24E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC27A4 in breast cancer [ 1 ]

Location

 Body (cg13463176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.44E-02; Z-score: -8.69E-01

Methylation in Case

 8.44E-01 (Median) Methylation in Control 8.68E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Bladder cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC27A4 in bladder cancer [ 2 ]

Location

 TSS1500 (cg13588599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.63E+00 Statistic Test p-value: 3.33E-13; Z-score: -1.59E+01

Methylation in Case

 2.24E-01 (Median) Methylation in Control 5.89E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC27A4 in bladder cancer [ 2 ]

Location

 Body (cg14128173)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 2.38E-02; Z-score: 2.66E+00

Methylation in Case

 9.50E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC27A4 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg13588599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 1.75E-10; Z-score: -3.72E+00

Methylation in Case

 5.92E-01 (Median) Methylation in Control 7.60E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC27A4 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg12076344)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 2.70E-02; Z-score: 4.30E-01

Methylation in Case

 2.11E-02 (Median) Methylation in Control 1.98E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC27A4 in colon adenocarcinoma [ 4 ]

Location

 TSS1500 (cg09746736)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.73E+00 Statistic Test p-value: 2.57E-08; Z-score: 5.05E+00

Methylation in Case

 6.17E-01 (Median) Methylation in Control 2.26E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC27A4 in colon adenocarcinoma [ 4 ]

Location

 Body (cg14075393)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 3.98E-03; Z-score: -1.65E+00

Methylation in Case

 7.85E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC27A4 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg12076344)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.63E-03; Z-score: 4.90E-01

Methylation in Case

 6.62E-02 (Median) Methylation in Control 5.86E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC27A4 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg13588599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 2.95E-02; Z-score: -5.15E-01

Methylation in Case

 3.92E-01 (Median) Methylation in Control 4.36E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC27A4 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg06958453)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.38E+00 Statistic Test p-value: 6.35E-16; Z-score: -1.42E+01

Methylation in Case

 6.91E-01 (Median) Methylation in Control 9.51E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC27A4 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg13588599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 7.92E-03; Z-score: -1.56E+00

Methylation in Case

 6.08E-01 (Median) Methylation in Control 7.02E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC27A4 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg13588599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.43E-02; Z-score: -7.41E-03

Methylation in Case

 8.06E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC27A4 in papillary thyroid cancer [ 7 ]

Location

 TSS200 (cg11893652)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.38E-02; Z-score: -3.16E-01

Methylation in Case

 7.82E-02 (Median) Methylation in Control 8.23E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC27A4 in papillary thyroid cancer [ 7 ]

Location

 Body (cg13463176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 7.54E-07; Z-score: -1.09E+00

Methylation in Case

 9.30E-01 (Median) Methylation in Control 9.40E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC27A4 in colorectal cancer [ 8 ]

Location

 Body (cg14359934)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.07E-02; Z-score: -5.82E-01

Methylation in Case

 9.17E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC27A4 in colorectal cancer [ 8 ]

Location

 Body (cg13463176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 4.53E-02; Z-score: -1.44E-01

Methylation in Case

 9.43E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC27A4 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg01160557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.79E+00 Statistic Test p-value: 3.60E-06; Z-score: -1.18E+00

Methylation in Case

 1.08E-01 (Median) Methylation in Control 1.92E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC27A4 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg24328816)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 6.97E-06; Z-score: 1.04E+00

Methylation in Case

 8.54E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC27A4 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg20925925)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 1.93E-03; Z-score: 9.30E-01

Methylation in Case

 8.83E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC27A4 in pancretic ductal adenocarcinoma [ 9 ]

Location

 3'UTR (ch.2.1685478R)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.36E+00 Statistic Test p-value: 8.68E-03; Z-score: -4.00E-01

Methylation in Case

 4.78E-02 (Median) Methylation in Control 6.52E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC27A4 in prostate cancer [ 10 ]

Location

 Body (cg03152870)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 4.35E-02; Z-score: 1.64E+00

Methylation in Case

 9.36E-01 (Median) Methylation in Control 7.91E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          42 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1 directly targets SLC27A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method Proteomics;Microarray

miRNA Stemloop ID

 miR-1 miRNA Mature ID miR-1-3p

miRNA Sequence

 UGGAAUGUAAAGAAGUAUGUAU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

 miR-16 directly targets SLC27A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 3

 miR-1827 directly targets SLC27A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1827 miRNA Mature ID miR-1827

miRNA Sequence

 UGAGGCAGUAGAUUGAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-1910 directly targets SLC27A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1910 miRNA Mature ID miR-1910-3p

miRNA Sequence

 GAGGCAGAAGCAGGAUGACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-193b directly targets SLC27A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-193b miRNA Mature ID miR-193b-5p

miRNA Sequence

 CGGGGUUUUGAGGGCGAGAUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-23a directly targets SLC27A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-23a miRNA Mature ID miR-23a-3p

miRNA Sequence

 AUCACAUUGCCAGGGAUUUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-2467 directly targets SLC27A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-2467 miRNA Mature ID miR-2467-3p

miRNA Sequence

 AGCAGAGGCAGAGAGGCUCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-3121 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3121 miRNA Mature ID miR-3121-5p

miRNA Sequence

 UCCUUUGCCUAUUCUAUUUAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-3170 directly targets SLC27A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3170 miRNA Mature ID miR-3170

miRNA Sequence

 CUGGGGUUCUGAGACAGACAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-3183 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3183 miRNA Mature ID miR-3183

miRNA Sequence

 GCCUCUCUCGGAGUCGCUCGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-3191 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3191 miRNA Mature ID miR-3191-5p

miRNA Sequence

 CUCUCUGGCCGUCUACCUUCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-326 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-326 miRNA Mature ID miR-326

miRNA Sequence

 CCUCUGGGCCCUUCCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-330 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-330 miRNA Mature ID miR-330-5p

miRNA Sequence

 UCUCUGGGCCUGUGUCUUAGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-3612 directly targets SLC27A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3612 miRNA Mature ID miR-3612

miRNA Sequence

 AGGAGGCAUCUUGAGAAAUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-3680 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3680 miRNA Mature ID miR-3680-5p

miRNA Sequence

 GACUCACUCACAGGAUUGUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-377 directly targets SLC27A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-377 miRNA Mature ID miR-377-5p

miRNA Sequence

 AGAGGUUGCCCUUGGUGAAUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-3977 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3977 miRNA Mature ID miR-3977

miRNA Sequence

 GUGCUUCAUCGUAAUUAACCUUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-4252 directly targets SLC27A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4252 miRNA Mature ID miR-4252

miRNA Sequence

 GGCCACUGAGUCAGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-4257 directly targets SLC27A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4257 miRNA Mature ID miR-4257

miRNA Sequence

 CCAGAGGUGGGGACUGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-4723 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4723 miRNA Mature ID miR-4723-3p

miRNA Sequence

 CCCUCUCUGGCUCCUCCCCAAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-4731 directly targets SLC27A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4731 miRNA Mature ID miR-4731-5p

miRNA Sequence

 UGCUGGGGGCCACAUGAGUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

 miR-4740 directly targets SLC27A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4740 miRNA Mature ID miR-4740-3p

miRNA Sequence

 GCCCGAGAGGAUCCGUCCCUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 23

 miR-4746 directly targets SLC27A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4746 miRNA Mature ID miR-4746-3p

miRNA Sequence

 AGCGGUGCUCCUGCGGGCCGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-4798 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4798 miRNA Mature ID miR-4798-3p

miRNA Sequence

 AACUCACGAAGUAUACCGAAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-518c directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-518c miRNA Mature ID miR-518c-5p

miRNA Sequence

 UCUCUGGAGGGAAGCACUUUCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-552 directly targets SLC27A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-552 miRNA Mature ID miR-552-3p

miRNA Sequence

 AACAGGUGACUGGUUAGACAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 27

 miR-5694 directly targets SLC27A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5694 miRNA Mature ID miR-5694

miRNA Sequence

 CAGAUCAUGGGACUGUCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-650 directly targets SLC27A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-650 miRNA Mature ID miR-650

miRNA Sequence

 AGGAGGCAGCGCUCUCAGGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-6511a directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6511a miRNA Mature ID miR-6511a-3p

miRNA Sequence

 CCUCACCAUCCCUUCUGCCUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-6511b directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6511b miRNA Mature ID miR-6511b-3p

miRNA Sequence

 CCUCACCACCCCUUCUGCCUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-6729 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6729 miRNA Mature ID miR-6729-3p

miRNA Sequence

 UCAUCCCCCUCGCCCUCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-6764 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6764 miRNA Mature ID miR-6764-3p

miRNA Sequence

 UCUCUGGUCUUUCCUUGACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-6769b directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6769b miRNA Mature ID miR-6769b-3p

miRNA Sequence

 CCCUCUCUGUCCCACCCAUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 34

 miR-6807 directly targets SLC27A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6807 miRNA Mature ID miR-6807-5p

miRNA Sequence

 GUGAGCCAGUGGAAUGGAGAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-6817 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6817 miRNA Mature ID miR-6817-3p

miRNA Sequence

 UCUCUCUGACUCCAUGGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 36

 miR-6824 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6824 miRNA Mature ID miR-6824-3p

miRNA Sequence

 UCUCUGGUCUUGCCACCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 37

 miR-6855 directly targets SLC27A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6855 miRNA Mature ID miR-6855-5p

miRNA Sequence

 UUGGGGUUUGGGGUGCAGACAUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 38

 miR-6885 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6885 miRNA Mature ID miR-6885-3p

miRNA Sequence

 CUUUGCUUCCUGCUCCCCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-6892 directly targets SLC27A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6892 miRNA Mature ID miR-6892-3p

miRNA Sequence

 UCCCUCUCCCACCCCUUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 40

 miR-7151 directly targets SLC27A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7151 miRNA Mature ID miR-7151-3p

miRNA Sequence

 CUACAGGCUGGAAUGGGCUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 41

 miR-7155 directly targets SLC27A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7155 miRNA Mature ID miR-7155-5p

miRNA Sequence

 UCUGGGGUCUUGGGCCAUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 42

 miR-764 directly targets SLC27A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-764 miRNA Mature ID miR-764

miRNA Sequence

 GCAGGUGCUCACUUGUCCUCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Genome-wide Scan for Methylation Profiles in Breast Cancer
2 DNA Methylation Dynamics in Urological Tumors.
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
12 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
13 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
14 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
15 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
16 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.