Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0003 Transporter Info
Gene Name	ABCB1
Transporter Name	P-glycoprotein 1
Gene ID	5243
UniProt ID	P08183

Epigenetic Regulations of This DT (EGR)
Methylation
Hematologic malignancies	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypomethylation of ABCB1 in hematologic malignancies			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Up regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Hematologic malignancies [ ICD-11: 2B33.Y]
Frequency	56% of the studied samples
Experimental Material	Patient tissue samples
Additional Notes	MDR1 promoter Hypomethylation conferred its up-regulation and indicated poor prognosis in patients with and without bone marrow transplantation.
Invasive ductal breast carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypomethylation of ABCB1 in invasive ductal breast carcinoma			[ 2 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Up regulation of ABCB1	Experiment Method	Immunohistochemistry
Studied Phenotype	Invasive ductal breast carcinoma [ ICD-11: 2C61.0]
Frequency	47 (47%) out of the 100 studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	Breast cancer patients with hypomethylated MDR1 promoter in tumors revealed shorter median overall survival (OS) (median OS = 18 months) as compared to patients having methylated MDR1 promoter.
Lung adenocarcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCB1 in lung adenocarcinoma			[ 3 ]
Location	Downstream promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Up regulation of ABCB1	Experiment Method	Western Blot
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Human lung adenocarcinoma cell line (A549)
Additional Notes	Hypermethylation of the ABCB1 gene correlated with increased ABCB1 gene expression and that increased ABCB1 gene expression and methylation were associated with the acquisition of resistance to the cisplatin analogue.
Epigenetic Phenomenon 2	Hypermethylation of ABCB1 in lung adenocarcinoma			[ 3 ]
Location	Downstream promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Up regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Human lung adenocarcinoma cell line (A549)
Additional Notes	Hypermethylation of the ABCB1 gene correlated with increased ABCB1 gene expression and that increased ABCB1 gene expression and methylation were associated with the acquisition of resistance to the cisplatin analogue.
Epigenetic Phenomenon 3	Methylation of ABCB1 in lung adenocarcinoma			[ 23 ]
Location	5'UTR (cg15759056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.89E+00	Statistic Test	p-value: 2.88E-02; Z-score: 4.86E+00
Methylation in Case	8.57E-02 (Median)	Methylation in Control	4.54E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB1 in lung adenocarcinoma			[ 23 ]
Location	5'UTR (cg22899422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.19E-02; Z-score: -1.46E+00
Methylation in Case	7.95E-01 (Median)	Methylation in Control	8.29E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB1 in lung adenocarcinoma			[ 23 ]
Location	5'UTR (cg00862116)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.59E+00	Statistic Test	p-value: 3.57E-02; Z-score: 7.32E+00
Methylation in Case	2.08E-01 (Median)	Methylation in Control	1.31E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB1 in lung adenocarcinoma			[ 23 ]
Location	5'UTR (cg12270822)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.32E+00	Statistic Test	p-value: 3.65E-02; Z-score: 1.85E+00
Methylation in Case	2.59E-01 (Median)	Methylation in Control	1.12E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCB1 in lung adenocarcinoma			[ 23 ]
Location	5'UTR (cg09105881)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.31E+00	Statistic Test	p-value: 4.17E-02; Z-score: 3.36E+00
Methylation in Case	1.85E-01 (Median)	Methylation in Control	1.42E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Cervical cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypomethylation of ABCB1 in cervical cancer			[ 4 ]
Location	Promoter (13 CpG sites)
Epigenetic Type	Methylation	Experiment Method	MALDI-TOF MS
Related Molecular Changes	Up regulation of ABCB1	Experiment Method	Immunohistochemistry
Studied Phenotype	Cervical cancer [ ICD-11: 2C77.Z]
Experimental Material	Patient tissue samples
Additional Notes	The methylation rate of CpG_2, 3, and 4 loci before chemotherapy in patients with effective chemotherapy was higher than patients with ineffective chemotherapy, and there was no difference in the methylation rate among the other CpG loci (P>0.05).
Malaria	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypomethylation of ABCB1 in malaria			[ 5 ]
Location	Downstream promoter (+245 to +679 bp)
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Up regulation of ABCB1	Experiment Method	Western Blot
Studied Phenotype	Malaria [ ICD-11: 1F40]
Experimental Material	Patient tissue samples
Additional Notes	Hypomethylation of downstream promoter region of ABCB1 results higher expression of ABCB1 protein in complicated malarial group.
Pancreatic cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypomethylation of ABCB1 in pancreatic cancer			[ 6 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Up regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Pancreatic cancer [ ICD-11: 2C10]
Experimental Material	Multiple cell lines of human
Additional Notes	ABCB1 expression correlated with pancreatic cancer tumorigenesis and drug resistance in a mechanism that is independent of promoter methylation.
Adult acute lymphocytic leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCB1 in adult acute lymphocytic leukemia			[ 7 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	Immunohistochemistry
Studied Phenotype	Adult acute lymphocytic leukemia [ ICD-11: 2A82]
Frequency	16% of the studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	There is an excellent correlation between ABCB1 methylation and ABCB1 protein expression.
Breast cancer	18 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCB1 in breast cancer			[ 8 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Frequency	70% of the studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	Methylation at the ABCB1 promoter improved overall survival probably due to prolonged availability and activity of the drug in the cell.
Epigenetic Phenomenon 2	Hypermethylation of ABCB1 in breast cancer			[ 9 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite pyrosequencing
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	Microarrays
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Frequency	>75% of the studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	The ABCB1 promoter was more frequently methylated in tumor tissues than in tumor-adjacent and tumor-distant tissues.
Epigenetic Phenomenon 3	Hypermethylation of ABCB1 in breast cancer			[ 12 ]
Location	Promoter (-100 to +500 bp)
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Additional Notes	ABCB1 promoter Hypermethylation is association with ABCB1 low expression in MCF-7 cell line.
Epigenetic Phenomenon 4	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	5'UTR (cg12270822)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.42E+00	Statistic Test	p-value: 4.58E-09; Z-score: 1.28E+00
Methylation in Case	1.22E-01 (Median)	Methylation in Control	8.60E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	5'UTR (cg06562372)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 7.58E-09; Z-score: 1.27E+00
Methylation in Case	1.51E-01 (Median)	Methylation in Control	1.25E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	5'UTR (cg27507700)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.53E+00	Statistic Test	p-value: 9.74E-09; Z-score: 1.81E+00
Methylation in Case	8.47E-02 (Median)	Methylation in Control	5.54E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	5'UTR (cg09105881)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 1.38E-08; Z-score: 1.52E+00
Methylation in Case	1.25E-01 (Median)	Methylation in Control	9.21E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	5'UTR (cg00862116)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.46E+00	Statistic Test	p-value: 2.67E-08; Z-score: 1.14E+00
Methylation in Case	9.86E-02 (Median)	Methylation in Control	6.76E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	5'UTR (cg16772035)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 2.13E-07; Z-score: 1.24E+00
Methylation in Case	8.59E-02 (Median)	Methylation in Control	6.50E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	5'UTR (cg00141548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 2.75E-07; Z-score: 1.28E+00
Methylation in Case	1.43E-01 (Median)	Methylation in Control	1.13E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	5'UTR (cg15759056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.54E+00	Statistic Test	p-value: 6.17E-07; Z-score: 1.03E+00
Methylation in Case	4.38E-02 (Median)	Methylation in Control	2.86E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	5'UTR (cg16288248)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 1.10E-05; Z-score: 8.79E-01
Methylation in Case	6.53E-02 (Median)	Methylation in Control	5.24E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	5'UTR (cg22899422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 8.70E-05; Z-score: -7.35E-01
Methylation in Case	7.48E-01 (Median)	Methylation in Control	7.78E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	Body (cg19861260)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.56E+00	Statistic Test	p-value: 1.35E-12; Z-score: -2.40E+00
Methylation in Case	4.10E-01 (Median)	Methylation in Control	6.39E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	Body (cg14319793)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 1.08E-08; Z-score: -1.80E+00
Methylation in Case	7.58E-01 (Median)	Methylation in Control	8.40E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	Body (cg25477497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 7.48E-05; Z-score: -9.95E-01
Methylation in Case	5.40E-01 (Median)	Methylation in Control	6.21E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	Body (cg24138422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 4.42E-02; Z-score: -3.26E-01
Methylation in Case	8.09E-01 (Median)	Methylation in Control	8.53E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 18	Methylation of ABCB1 in breast cancer			[ 17 ]
Location	Body (cg23479988)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 4.87E-02; Z-score: -5.53E-01
Methylation in Case	7.74E-01 (Median)	Methylation in Control	8.41E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Invasive ductal carcinoma of breast	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCB1 in Invasive ductal carcinoma of breast			[ 10 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite pyrosequencing
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-PCR
Studied Phenotype	Invasive ductal carcinoma of breast [ ICD-11: 2C61.0]
Frequency	40% of the studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	DNA methylation levels of ABCB1 was higher in oestrogen receptor (ER) positive vs. ER negative tumours; whereas methylation levels of ABCB1 was lower in tumours with a TP53 mutation.
Prostate cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCB1 in prostate cancer			[ 11 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Frequency	72% of the studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p < 0.001).
Epigenetic Phenomenon 2	Methylation of ABCB1 in prostate cancer			[ 28 ]
Location	TSS1500 (cg22844229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.82E+00	Statistic Test	p-value: 1.43E-02; Z-score: -1.77E+00
Methylation in Case	2.42E-01 (Median)	Methylation in Control	4.40E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB1 in prostate cancer			[ 28 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.46E+00	Statistic Test	p-value: 3.71E-02; Z-score: -4.52E+00
Methylation in Case	1.69E-01 (Median)	Methylation in Control	2.48E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB1 in prostate cancer			[ 28 ]
Location	TSS1500 (cg02322908)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.75E+00	Statistic Test	p-value: 4.52E-02; Z-score: 4.67E+00
Methylation in Case	2.28E-01 (Median)	Methylation in Control	1.30E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB1 in prostate cancer			[ 28 ]
Location	Body (cg16614288)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 3.88E-02; Z-score: 1.81E+00
Methylation in Case	8.33E-01 (Median)	Methylation in Control	6.78E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB1 in prostate cancer			[ 28 ]
Location	Body (cg27005847)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 4.00E-02; Z-score: -1.52E+00
Methylation in Case	4.31E-01 (Median)	Methylation in Control	5.73E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCB1 in prostate cancer			[ 28 ]
Location	Body (cg16374080)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 4.14E-02; Z-score: 1.64E+00
Methylation in Case	8.63E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCB1 in prostate cancer			[ 28 ]
Location	3'UTR (cg24042313)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.48E+00	Statistic Test	p-value: 4.03E-02; Z-score: 6.93E+00
Methylation in Case	6.32E-01 (Median)	Methylation in Control	4.26E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Newborns with tetralogy of fallot	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCB1 in newborns with tetralogy of fallot			[ 13 ]
Location	cg25477497
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	GDAC database
Studied Phenotype	Newborns with tetralogy of fallot [ ICD-11: LA88.2]
Experimental Material	Patient tissue samples
Additional Notes	ABCB1 is differentially methylated in the blood DNA of newborns with TOF compared with controls.
Glioblastoma multiforme	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCB1 in glioblastoma multiforme			[ 14 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite pyrosequencing
Related Molecular Changes	level of ABCB1 Unchanged	Experiment Method	RT-qPCR
Studied Phenotype	Glioblastoma multiforme [ ICD-11: 2A00.00]
Experimental Material	Patient tissue samples
Additional Notes	No association between ABCB1 promoter methylation and ABCB1 expression or overall survival was seen.
Atypical teratoid rhabdoid tumor	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB1 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	5'UTR (cg00141548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 3.99E-09; Z-score: -1.49E+00
Methylation in Case	6.88E-01 (Median)	Methylation in Control	7.91E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB1 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	5'UTR (cg00862116)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 6.82E-09; Z-score: -1.38E+00
Methylation in Case	5.18E-01 (Median)	Methylation in Control	5.68E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB1 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	5'UTR (cg04099454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 2.59E-08; Z-score: 1.54E+00
Methylation in Case	8.14E-01 (Median)	Methylation in Control	6.34E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB1 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	5'UTR (cg06562372)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 6.25E-08; Z-score: -1.67E+00
Methylation in Case	8.34E-01 (Median)	Methylation in Control	8.71E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB1 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	5'UTR (cg09105881)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 1.59E-07; Z-score: -1.24E+00
Methylation in Case	7.86E-01 (Median)	Methylation in Control	8.82E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB1 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	5'UTR (cg12270822)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 3.67E-07; Z-score: 1.01E+00
Methylation in Case	8.66E-01 (Median)	Methylation in Control	7.07E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCB1 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	5'UTR (cg15759056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.54E+00	Statistic Test	p-value: 1.59E-06; Z-score: 1.30E+00
Methylation in Case	6.25E-01 (Median)	Methylation in Control	4.05E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCB1 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	5'UTR (cg16288248)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.89E+00	Statistic Test	p-value: 1.74E-06; Z-score: -1.17E+00
Methylation in Case	1.91E-01 (Median)	Methylation in Control	3.61E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCB1 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	5'UTR (cg16772035)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.84E-06; Z-score: -9.22E-01
Methylation in Case	8.39E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCB1 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	5'UTR (cg22899422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 6.55E-06; Z-score: -6.93E-01
Methylation in Case	5.25E-01 (Median)	Methylation in Control	6.18E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCB1 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	5'UTR (cg27507700)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.40E-05; Z-score: -9.46E-01
Methylation in Case	7.40E-01 (Median)	Methylation in Control	8.08E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCB1 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg14319793)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 4.49E-02; Z-score: -3.72E-01
Methylation in Case	9.01E-01 (Median)	Methylation in Control	9.29E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	5'UTR (cg04099454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.25E+00	Statistic Test	p-value: 3.97E-11; Z-score: -5.54E+01
Methylation in Case	4.11E-01 (Median)	Methylation in Control	9.24E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	5'UTR (cg22899422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.57E+00	Statistic Test	p-value: 1.65E-07; Z-score: -2.74E+01
Methylation in Case	5.21E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	5'UTR (cg16772035)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.90E+00	Statistic Test	p-value: 1.62E-04; Z-score: 9.95E+00
Methylation in Case	1.39E-01 (Median)	Methylation in Control	7.32E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	5'UTR (cg16288248)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.47E+00	Statistic Test	p-value: 6.46E-04; Z-score: 2.76E+00
Methylation in Case	8.15E-02 (Median)	Methylation in Control	5.53E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	5'UTR (cg00141548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 8.47E-04; Z-score: 3.64E+00
Methylation in Case	1.64E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	5'UTR (cg09105881)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.50E+00	Statistic Test	p-value: 1.62E-03; Z-score: 4.85E+00
Methylation in Case	1.38E-01 (Median)	Methylation in Control	9.19E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	5'UTR (cg27507700)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.53E+00	Statistic Test	p-value: 2.28E-03; Z-score: 6.16E+00
Methylation in Case	8.75E-02 (Median)	Methylation in Control	5.72E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	5'UTR (cg15759056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.90E+00	Statistic Test	p-value: 4.36E-03; Z-score: 7.20E+00
Methylation in Case	5.76E-02 (Median)	Methylation in Control	3.03E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	5'UTR (cg12270822)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 5.21E-03; Z-score: 2.21E+00
Methylation in Case	1.23E-01 (Median)	Methylation in Control	8.91E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	5'UTR (cg06562372)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 8.22E-03; Z-score: -2.73E-01
Methylation in Case	1.56E-01 (Median)	Methylation in Control	1.58E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	5'UTR (cg00862116)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 1.20E-02; Z-score: 1.76E+00
Methylation in Case	9.22E-02 (Median)	Methylation in Control	7.35E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	Body (cg14319793)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 1.29E-06; Z-score: -6.15E+00
Methylation in Case	6.92E-01 (Median)	Methylation in Control	8.73E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	Body (cg19861260)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.91E+00	Statistic Test	p-value: 8.55E-06; Z-score: -8.13E+00
Methylation in Case	2.33E-01 (Median)	Methylation in Control	4.45E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	Body (cg24138422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 2.26E-03; Z-score: -6.38E+00
Methylation in Case	7.15E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	Body (cg25477497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 9.48E-03; Z-score: -2.09E+00
Methylation in Case	5.29E-01 (Median)	Methylation in Control	6.20E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of ABCB1 in bladder cancer			[ 16 ]
Location	Body (cg23479988)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.18E-02; Z-score: -1.76E+00
Methylation in Case	7.49E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Renal cell carcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB1 in clear cell renal cell carcinoma			[ 18 ]
Location	5'UTR (cg00141548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.58E+00	Statistic Test	p-value: 5.64E-04; Z-score: -7.53E-01
Methylation in Case	6.12E-02 (Median)	Methylation in Control	9.65E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB1 in clear cell renal cell carcinoma			[ 18 ]
Location	Body (cg25477497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 3.97E-04; Z-score: -2.29E+00
Methylation in Case	4.99E-01 (Median)	Methylation in Control	6.19E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB1 in clear cell renal cell carcinoma			[ 18 ]
Location	Body (cg19861260)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 4.16E-03; Z-score: -1.64E+00
Methylation in Case	3.36E-01 (Median)	Methylation in Control	4.69E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	5'UTR (cg04099454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 2.79E-09; Z-score: -3.46E+00
Methylation in Case	6.58E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	5'UTR (cg09105881)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.54E-04; Z-score: 3.66E-01
Methylation in Case	1.27E-01 (Median)	Methylation in Control	1.16E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	5'UTR (cg27507700)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 1.75E-04; Z-score: 5.19E-01
Methylation in Case	8.79E-02 (Median)	Methylation in Control	7.60E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	5'UTR (cg22899422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 2.19E-04; Z-score: -1.36E+00
Methylation in Case	8.80E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	5'UTR (cg06562372)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 3.39E-04; Z-score: 5.07E-01
Methylation in Case	8.65E-02 (Median)	Methylation in Control	7.74E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	5'UTR (cg12270822)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 4.08E-04; Z-score: 2.20E-01
Methylation in Case	1.06E-01 (Median)	Methylation in Control	9.90E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	5'UTR (cg00141548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 4.10E-04; Z-score: 6.59E-01
Methylation in Case	1.51E-01 (Median)	Methylation in Control	1.25E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	5'UTR (cg16288248)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.17E-03; Z-score: -8.40E-02
Methylation in Case	1.07E-01 (Median)	Methylation in Control	1.09E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	5'UTR (cg15759056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 2.34E-03; Z-score: -1.50E-01
Methylation in Case	2.16E-02 (Median)	Methylation in Control	2.34E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	5'UTR (cg00862116)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.73E-03; Z-score: -4.18E-02
Methylation in Case	9.36E-02 (Median)	Methylation in Control	9.54E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	5'UTR (cg16772035)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 3.28E-03; Z-score: 3.76E-02
Methylation in Case	1.08E-01 (Median)	Methylation in Control	1.07E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	Body (cg25477497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.80E+00	Statistic Test	p-value: 2.90E-08; Z-score: -2.04E+00
Methylation in Case	4.10E-01 (Median)	Methylation in Control	7.37E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	Body (cg19861260)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.96E+00	Statistic Test	p-value: 6.91E-06; Z-score: -1.70E+00
Methylation in Case	2.34E-01 (Median)	Methylation in Control	4.59E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	Body (cg23479988)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 3.57E-04; Z-score: -1.53E+00
Methylation in Case	8.75E-01 (Median)	Methylation in Control	9.10E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of ABCB1 in colorectal cancer			[ 19 ]
Location	Body (cg24138422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 6.68E-03; Z-score: -1.71E-01
Methylation in Case	9.21E-01 (Median)	Methylation in Control	9.25E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Hypermethylation of ABCB1 in colorectal cancer			[ 47 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Frequency	69% of the studied tumor samples
Experimental Material	Korean patient tissue samples
Additional Notes	The Hypermethylation of ABCB1 in cancer tissues was not significantly associated with any clinical parameters.
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB1 in depression			[ 20 ]
Location	5'UTR (cg00862116)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 4.70E-02; Z-score: 5.25E-01
Methylation in Case	5.23E-02 (Median)	Methylation in Control	4.80E-02 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB1 in hepatocellular carcinoma			[ 21 ]
Location	5'UTR (cg00141548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 1.21E-07; Z-score: -1.16E+00
Methylation in Case	9.07E-02 (Median)	Methylation in Control	1.09E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB1 in hepatocellular carcinoma			[ 21 ]
Location	5'UTR (cg12270822)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 8.63E-04; Z-score: -5.36E-01
Methylation in Case	6.11E-02 (Median)	Methylation in Control	6.86E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB1 in hepatocellular carcinoma			[ 21 ]
Location	5'UTR (cg27507700)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 2.34E-03; Z-score: -8.69E-01
Methylation in Case	5.26E-02 (Median)	Methylation in Control	5.92E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB1 in hepatocellular carcinoma			[ 21 ]
Location	5'UTR (cg00862116)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 2.53E-03; Z-score: -4.81E-01
Methylation in Case	5.88E-02 (Median)	Methylation in Control	6.78E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB1 in hepatocellular carcinoma			[ 21 ]
Location	5'UTR (cg04099454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 4.73E-03; Z-score: -1.96E-01
Methylation in Case	8.50E-01 (Median)	Methylation in Control	8.74E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB1 in hepatocellular carcinoma			[ 21 ]
Location	5'UTR (cg22899422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.59E-02; Z-score: -1.66E-01
Methylation in Case	8.09E-01 (Median)	Methylation in Control	8.15E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCB1 in hepatocellular carcinoma			[ 21 ]
Location	TSS1500 (cg13362272)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 6.67E-11; Z-score: -4.26E+00
Methylation in Case	7.56E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCB1 in hepatocellular carcinoma			[ 21 ]
Location	TSS1500 (cg20038225)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 7.98E-11; Z-score: -3.31E+00
Methylation in Case	6.83E-01 (Median)	Methylation in Control	8.05E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCB1 in hepatocellular carcinoma			[ 21 ]
Location	1stExon (cg12501142)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 2.97E-10; Z-score: -5.15E+00
Methylation in Case	7.32E-01 (Median)	Methylation in Control	8.50E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of ABCB1 in hepatocellular carcinoma			[ 21 ]
Location	Body (cg23260105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 3.23E-11; Z-score: -1.15E+01
Methylation in Case	8.18E-01 (Median)	Methylation in Control	9.75E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of ABCB1 in hepatocellular carcinoma			[ 21 ]
Location	Body (cg25477497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 1.15E-04; Z-score: -1.05E+00
Methylation in Case	2.27E-01 (Median)	Methylation in Control	2.95E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of ABCB1 in hepatocellular carcinoma			[ 21 ]
Location	Body (cg19861260)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 7.57E-04; Z-score: -1.41E+00
Methylation in Case	1.65E-01 (Median)	Methylation in Control	2.31E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of ABCB1 in hepatocellular carcinoma			[ 21 ]
Location	3'UTR (cg23533270)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.45E+00	Statistic Test	p-value: 1.26E-11; Z-score: -1.65E+00
Methylation in Case	4.39E-01 (Median)	Methylation in Control	6.37E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB1 in HIV infection			[ 22 ]
Location	5'UTR (cg00862116)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 6.15E-05; Z-score: 1.14E+00
Methylation in Case	5.53E-02 (Median)	Methylation in Control	4.25E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB1 in HIV infection			[ 22 ]
Location	5'UTR (cg16772035)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.31E+00	Statistic Test	p-value: 5.48E-03; Z-score: 1.64E+00
Methylation in Case	8.79E-02 (Median)	Methylation in Control	6.73E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB1 in HIV infection			[ 22 ]
Location	5'UTR (cg22899422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.31E-02; Z-score: -9.71E-01
Methylation in Case	9.07E-01 (Median)	Methylation in Control	9.28E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB1 in HIV infection			[ 22 ]
Location	5'UTR (cg09105881)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 4.24E-02; Z-score: 6.62E-01
Methylation in Case	9.70E-02 (Median)	Methylation in Control	8.75E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB1 in HIV infection			[ 22 ]
Location	5'UTR (cg15759056)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.79E+00	Statistic Test	p-value: 4.30E-02; Z-score: 8.28E-01
Methylation in Case	9.18E-03 (Median)	Methylation in Control	5.12E-03 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB1 in HIV infection			[ 22 ]
Location	Body (cg24138422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 3.40E-05; Z-score: 9.93E-01
Methylation in Case	9.20E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCB1 in HIV infection			[ 22 ]
Location	Body (cg25477497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 1.76E-04; Z-score: 1.20E+00
Methylation in Case	8.33E-02 (Median)	Methylation in Control	6.55E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCB1 in HIV infection			[ 22 ]
Location	Body (cg19861260)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.39E+00	Statistic Test	p-value: 3.60E-03; Z-score: 1.13E+00
Methylation in Case	1.27E-01 (Median)	Methylation in Control	9.12E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of ABCB1 in HIV infection			[ 22 ]
Location	Body (cg14319793)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.18E-02; Z-score: -5.41E-01
Methylation in Case	9.09E-01 (Median)	Methylation in Control	9.36E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB1 in pancretic ductal adenocarcinoma			[ 24 ]
Location	5'UTR (cg13765368)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.49E+00	Statistic Test	p-value: 3.85E-15; Z-score: 2.17E+00
Methylation in Case	1.26E-01 (Median)	Methylation in Control	8.46E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB1 in pancretic ductal adenocarcinoma			[ 24 ]
Location	TSS1500 (cg23099740)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 2.70E-09; Z-score: 1.36E+00
Methylation in Case	6.57E-01 (Median)	Methylation in Control	6.05E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB1 in pancretic ductal adenocarcinoma			[ 24 ]
Location	TSS1500 (cg10017118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.43E-02; Z-score: 3.37E-01
Methylation in Case	5.79E-01 (Median)	Methylation in Control	5.62E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB1 in pancretic ductal adenocarcinoma			[ 24 ]
Location	TSS200 (cg11960629)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.10E+00	Statistic Test	p-value: 1.05E-20; Z-score: 3.72E+00
Methylation in Case	1.82E-01 (Median)	Methylation in Control	8.65E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB1 in pancretic ductal adenocarcinoma			[ 24 ]
Location	TSS200 (cg08074851)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.79E+00	Statistic Test	p-value: 2.91E-18; Z-score: 3.35E+00
Methylation in Case	3.99E-01 (Median)	Methylation in Control	1.43E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCB1 in pancretic ductal adenocarcinoma			[ 24 ]
Location	TSS200 (cg13052102)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 2.11E-02; Z-score: 2.83E-01
Methylation in Case	5.30E-02 (Median)	Methylation in Control	5.02E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCB1 in pancretic ductal adenocarcinoma			[ 24 ]
Location	Body (cg24334149)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 3.97E-07; Z-score: -1.56E+00
Methylation in Case	4.58E-01 (Median)	Methylation in Control	5.70E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCB1 in pancretic ductal adenocarcinoma			[ 24 ]
Location	Body (cg05207973)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 5.44E-07; Z-score: 8.56E-01
Methylation in Case	6.96E-01 (Median)	Methylation in Control	6.32E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB1 in panic disorder			[ 25 ]
Location	5'UTR (cg04099454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 1.67E-02; Z-score: -4.72E-01
Methylation in Case	5.42E-01 (Median)	Methylation in Control	7.22E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB1 in panic disorder			[ 25 ]
Location	5'UTR (cg22899422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 4.18E-02; Z-score: -3.26E-01
Methylation in Case	1.08E+00 (Median)	Methylation in Control	1.20E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB1 in panic disorder			[ 25 ]
Location	Body (cg25477497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 8.60E-01	Statistic Test	p-value: 2.38E-06; Z-score: 8.27E-01
Methylation in Case	-2.53E+00 (Median)	Methylation in Control	-2.94E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB1 in panic disorder			[ 25 ]
Location	Body (cg24138422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.91E+00	Statistic Test	p-value: 2.54E-04; Z-score: -8.53E-01
Methylation in Case	5.17E-01 (Median)	Methylation in Control	9.85E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCB1 in panic disorder			[ 25 ]
Location	Body (cg23479988)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -6.21E-01	Statistic Test	p-value: 3.15E-02; Z-score: -4.69E-01
Methylation in Case	-4.38E-01 (Median)	Methylation in Control	-2.72E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB1 in papillary thyroid cancer			[ 26 ]
Location	5'UTR (cg22899422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 4.89E-08; Z-score: -1.58E+00
Methylation in Case	8.63E-01 (Median)	Methylation in Control	9.05E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB1 in papillary thyroid cancer			[ 26 ]
Location	5'UTR (cg16772035)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 4.41E-03; Z-score: 7.40E-01
Methylation in Case	8.02E-02 (Median)	Methylation in Control	6.70E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB1 in papillary thyroid cancer			[ 26 ]
Location	5'UTR (cg09105881)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 3.23E-02; Z-score: 4.29E-01
Methylation in Case	9.18E-02 (Median)	Methylation in Control	8.54E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCB1 in papillary thyroid cancer			[ 26 ]
Location	Body (cg25477497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 4.92E-03; Z-score: -4.57E-01
Methylation in Case	8.08E-01 (Median)	Methylation in Control	8.42E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB1 in systemic lupus erythematosus			[ 27 ]
Location	5'UTR (cg22899422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.14E-02; Z-score: -2.60E-01
Methylation in Case	8.92E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB1 in systemic lupus erythematosus			[ 27 ]
Location	Body (cg25477497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 2.74E-02; Z-score: 1.95E-01
Methylation in Case	9.84E-02 (Median)	Methylation in Control	9.23E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB1 in systemic lupus erythematosus			[ 27 ]
Location	Body (cg24138422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.61E-02; Z-score: -1.99E-01
Methylation in Case	9.15E-01 (Median)	Methylation in Control	9.20E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Colon cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCB1 in colon adenocarcinoma			[ 29 ]
Location	Body (cg24474319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 9.45E-05; Z-score: -2.54E+00
Methylation in Case	4.82E-01 (Median)	Methylation in Control	5.60E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCB1 in colon adenocarcinoma			[ 29 ]
Location	Body (cg10860553)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 1.26E-04; Z-score: -3.46E+00
Methylation in Case	4.74E-01 (Median)	Methylation in Control	5.89E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCB1 in colon adenocarcinoma			[ 29 ]
Location	Body (cg16793755)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 6.76E-04; Z-score: -2.17E+00
Methylation in Case	6.13E-01 (Median)	Methylation in Control	7.07E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Adult acute myeloid leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCB1 in adult acute myeloid leukemia			[ 46 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-sensitive melting curve analysis
Studied Phenotype	Adult acute myeloid leukemia [ ICD-11: 2A60]
Frequency	11 (4%) out of the 287 studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	There is a difference of methylation of ABCB1 between childhood and adult AML.
Childhood acute myeloid leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCB1 in childhood acute myeloid leukemia			[ 46 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-sensitive melting curve analysis
Studied Phenotype	Childhood acute myeloid leukemia [ ICD-11: 2A60]
Frequency	5 (8%) out of the 66 studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	No significant impact on prognosis was seen for promoter Hypermethylation in ABCB1.
Gastric cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCB1 in gastric carcinogenesis			[ 48 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Studied Phenotype	Gastric cancer [ ICD-11: 2B72]
Frequency	31% of the studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	The methylation ratio (MR) of the cancer lesions (31.3 +/- 20.5) was significantly higher than that of non non-neoplastic mucosa (20.9 +/- 31.3, p = 0.0004).
Non-small cell lung cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCB1 in non-small cell lung cancer			[ 49 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Studied Phenotype	Non-small cell lung cancer [ ICD-11: 2C25.4]
Frequency	31 (24%) out of the 124 studied tumor samples
Experimental Material	Chinese patient tissue samples
Additional Notes	The frequency of methylation of ABCB1 is disparity between the mainland of China and the United States in the NSCLC populations.
Intracranial artery stenosis	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypomethylation of ABCB1 in intracranial artery stenosis			[ 50 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Studied Phenotype	Intracranial artery stenosis [ ICD-11: BD55]
Experimental Material	Chinese patient tissue samples
Additional Notes	ABCB1 promoter methylation is association with aspirin exposure, platelet function, and clinical outcomes in Chinese intracranial artery stenosis patients.
Histone acetylation
Acute myeloid leukemia	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of ABCB1 in acute myeloid leukemia (compare with valproate-treatment counterpart AML cells)			[ 30 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Acute myeloid leukemia [ ICD-11: 2A60]
Experimental Material	Multiple cell lines of human
Additional Notes	Chromatin immunoprecipitation revealed the hyperacetylation of histone proteins in the promoter regions of MDR1 on valproate treatment.
Epigenetic Phenomenon 2	Hypoacetylation of ABCB1 in AML (compare with valproate treatment counterpart cells)			[ 30 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	Western Blot
Studied Phenotype	Acute myeloid leukemia [ ICD-11: 2A60]
Experimental Material	Multiple cell lines of human
Additional Notes	Hyperacetylation of histone proteins in the promoter regions of MDR1 on valproate treatment.
Breast cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of ABCB1 in breast cancer (compare with doxorubicin-resistant counterpart cells)			[ 31 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Multiple cell lines of human
Additional Notes	Elevated level of lysine 9-acetylated histone H3 at the MDR1 promoter in doxorubicinresistant MCF-7 cells.
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of ABCB1 in lymphoid tumour (compare with etoposide-resistant counterpart cells)			[ 32 ]
Location	Exon 1
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Lymphoma [ ICD-11: 2B30]
Experimental Material	Multiple cell lines of human
Additional Notes	Histone H3 acetylation in the same CpG island was significantly increased in drug-resistant cell line.
Sarcoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of ABCB1 in sarcoma (compare with multidrug-resistant counterpart cells)			[ 33 ]
Location	968 bp upstream of exon 1
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Sarcoma [ ICD-11: 2A60.39]
Experimental Material	Multiple cell lines of human
Additional Notes	The chromatin structure of the ABCB1 upstream promoter is changed via acetylation of histone H3 initiating ABCB1 activation.
Small cell lung cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of ABCB1 in SCLC (compare with etoposide-resistant counterpart cells)			[ 34 ]
Location	Distal promoter (-981 to -817)
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Small cell lung cancer [ ICD-11: 2C25.1]
Experimental Material	Human small cell lung carcinoma cell line (H69)
Additional Notes	High acetylation level of histone H3 of ABCB1 in etoposide-resistant small cell lung carcinoma associated with higher ABCB1 expression.
Epigenetic Phenomenon 2	Hypoacetylation of ABCB1 in SCLC (compare with etoposide-resistant counterpart cells)			[ 34 ]
Location	Promoter (-981 to -817 and -222 to +37)
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Small cell lung cancer [ ICD-11: 2C25.1]
Experimental Material	Multiple cell lines of human
Additional Notes	TSA induces downregulation of ABCB1 expression in drug-resistant SCLC cell line, independently of promoter methylation, and MBD1 or PCAF recruitment.
Epigenetic Phenomenon 3	Hypoacetylation of ABCB1 in SCLC (compare with etoposide-resistant counterpart cells)			[ 34 ]
Location	Promoter (-981 to -817 and -222 to +37)
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Small cell lung cancer [ ICD-11: 2C25.1]
Experimental Material	Multiple cell lines of human
Additional Notes	TSA induces downregulation of ABCB1 expression in drug-resistant SCLC cell line, independently of promoter methylation, and MBD1 or PCAF recruitment.
Epigenetic Phenomenon 4	Hypoacetylation of ABCB1 in SCLC (compare with etoposide-resistant counterpart cells)			[ 34 ]
Location	Proximal promoter (+292 to +591)
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Small cell lung cancer [ ICD-11: 2C25.1]
Experimental Material	Human small cell lung carcinoma cell line (H69)
Additional Notes	High acetylation level of histone H3 of ABCB1 in etoposide-resistant small cell lung carcinoma associated with higher ABCB1 expression.
Epigenetic Phenomenon 5	Hypoacetylation of ABCB1 in SCLC (compare with etoposide-resistant counterpart cells)			[ 34 ]
Location	Proximal promoter (+292 to +591)
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Small cell lung cancer [ ICD-11: 2C25.1]
Experimental Material	Human small cell lung carcinoma cell line (H69)
Additional Notes	High acetylation level of histone H4 of ABCB1 in etoposide-resistant small cell lung carcinoma associated with higher ABCB1 expression.
Promyeloblastic leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypoacetylation of ABCB1 in promyeloblastic leukemia (compare with valproate-treatment counterpart AML cells)			[ 35 ]
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
Studied Phenotype	Promyeloblastic leukemia [ ICD-11: 2A60.0]
Experimental Material	Human leukemia stem cell-like cell line (KG-1a)
Additional Notes	Exposure of promyeloblastic leukemia cells for 24 h to 2 mM of the weak histone deacetylase inhibitor phenylbutyrate resulted in enhanced and marked expression of P-glycoprotein.
microRNA
Gastric cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher expression of miR-129-5p in gastric cancer (compare with cisplatin-resistant counterpart cells)			[ 36 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	Western Blot
miRNA Stemloop ID	miR-129	miRNA Mature ID	miR-129-5p
miRNA Sequence	CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type	Direct
Studied Phenotype	Gastric cancer [ ICD-11: 2B72]
Experimental Material	Patient tissue samples
Additional Notes	miR-129 enhances chemosensitivity to cisplatin by suppressing P-gp protein in GC cells.
Epigenetic Phenomenon 2	Higher expression of miR-508-5p in gastric cancer (compare to multidrug resistance counterpart cells)			[ 41 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	Western Blot
miRNA Stemloop ID	miR-508	miRNA Mature ID	miR-508-5p
miRNA Sequence	UACUCCAGAGGGCGUCACUCAUG
miRNA Target Type	Direct
Studied Phenotype	Gastric cancer [ ICD-11: 2B72]
Experimental Material	Multiple cell lines of human
Additional Notes	By targeting ABCB1 and ZNRD1, miR-508-5p overexpression decreases the intracellular concentration of chemotherapeutics and promotes drug-induced apoptosis in MDR gastric cancer cells.
Epigenetic Phenomenon 3	miR-129-5p downregulates of ABCB1 in gastric cancer			[ 45 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	Western Blot
miRNA Stemloop ID	miR-129	miRNA Mature ID	miR-129-5p
miRNA Sequence	CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type	Direct
Studied Phenotype	Gastric cancer [ ICD-11: 2B72]
Experimental Material	Human gastric adenocarcinoma cell line (SGC7901)
Additional Notes	miR-129-5p reduces ABCB1 expression in vivo at the post-transcriptional level.
Breast cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher expression of miR-137 in breast cancer (compare with multidrug-resistant counterpart cells)			[ 37 ]
Epigenetic Type	microRNA	Experiment Method	Dual-luciferase reporter assay
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	Western Blot
miRNA Stemloop ID	miR-137	miRNA Mature ID	Unclear
miRNA Target Type	Indirect(YB-1;ABCB1)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Additional Notes	miR-137 was involved in MDR in cancer through modulation of P-gp by targeting YB-1.
Ovarian cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher expression of miR-186 in ovarian cancer (compare with cisplatin-resistant counterpart cells)			[ 38 ]
Epigenetic Type	microRNA	Experiment Method	Dual-luciferase reporter assay
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-186	miRNA Mature ID	miR-186-5p
miRNA Sequence	CAAAGAAUUCUCCUUUUGGGCU
miRNA Target Type	Direct
Studied Phenotype	Ovarian cancer [ ICD-11: 2C73]
Experimental Material	Multiple cell lines of human
Additional Notes	miR-186 overexpression may increase the sensitivity of ovarian cancer cells to paclitaxel and cisplatin by targeting ABCB1.
Epigenetic Phenomenon 2	Higher expression of miR-186 in ovarian cancer (compare with cisplatin-resistant counterpart cells)			[ 38 ]
Epigenetic Type	microRNA	Experiment Method	Dual-luciferase reporter assay
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	Western Blot
miRNA Stemloop ID	miR-186	miRNA Mature ID	miR-186-5p
miRNA Sequence	CAAAGAAUUCUCCUUUUGGGCU
miRNA Target Type	Direct
Studied Phenotype	Ovarian cancer [ ICD-11: 2C73]
Experimental Material	Multiple cell lines of human
Additional Notes	miR-186 overexpression may increase the sensitivity of ovarian cancer cells to paclitaxel and cisplatin by targeting ABCB1.
Chronic myeloid leukemia	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher expression of miR-214 in CML (compare with imatinib mesylate resistant counterpart cells)			[ 39 ]
Epigenetic Type	microRNA	Experiment Method	Dual-luciferase reporter assay
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	Western Blot
miRNA Stemloop ID	miR-214	miRNA Mature ID	miR-214-5p
miRNA Sequence	UGCCUGUCUACACUUGCUGUGC
miRNA Target Type	Direct
Studied Phenotype	Chronic myeloid leukemia [ ICD-11: 2B33.1]
Experimental Material	Patient tissue samples
Additional Notes	Decreased expression of microRNA-214 contributes to imatinib mesylate resistance of chronic myeloid leukemia patients by upregulating ABCB1 gene expression.
Epigenetic Phenomenon 2	Higher expression of miR-9 in CML (compare with adriamycin resistant counterpart cells)			[ 42 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	Western Blot
miRNA Stemloop ID	miR-9	miRNA Mature ID	miR-9-3p
miRNA Sequence	AUAAAGCUAGAUAACCGAAAGU
miRNA Target Type	Direct
Studied Phenotype	Chronic myeloid leukemia [ ICD-11: 2B33.1]
Experimental Material	Patient tissue samples, Multiple cell lines of human
Additional Notes	miR-9 and P-glycoprotein (P-gp) had a negative correlation in the CML patients, and the expression of miR-9 was increased in the CML.
Hepatocellular carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher expression of miR-223 in HCC (compare with multidrug resistance counterpart cells)			[ 40 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	Western Blot
miRNA Stemloop ID	miR-223	miRNA Mature ID	miR-223-3p
miRNA Sequence	UGUCAGUUUGUCAAAUACCCCA
miRNA Target Type	Direct
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Multiple cell lines of human
Additional Notes	miR-223 modulates multidrug resistance via downregulation of ABCB1 in hepatocellular carcinoma cells
Colorectal cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Lower expression of miR-491-3p in colorectal cancer (compare to atorvastatin treatment cells)			[ 43 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-491	miRNA Mature ID	miR-491-3p
miRNA Sequence	CUUAUGCAAGAUUCCCUUCUAC
miRNA Target Type	Direct
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Human epithelial colorectal adenocarcinoma cell line(Caco-2)
Additional Notes	Atorvastatin attenuation of ABCB1 expression is mediated by microRNA miR-491-3p in Caco-2 cells.
Acute myeloid leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1-3p downregulates of ABCB1 in acute myeloid leukemia			[ 44 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCB1	Experiment Method	Western Blot
miRNA Stemloop ID	miR-1	miRNA Mature ID	miR-1-3p
miRNA Sequence	UGGAAUGUAAAGAAGUAUGUAU
miRNA Target Type	Direct
Studied Phenotype	Acute myeloid leukemia [ ICD-11: 2A60]
Experimental Material	Multiple cell lines of human
Additional Notes	PI3K/mTOR dual inhibitor BEZ235 effectively chemosensitizes AML cells via increasing miR-1-3p and subsequently down-regulating BAG4, EDN1 and ABCB1.
Unclear Phenotype	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1 directly targets ABCB1			[ 44 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay//qRT-PCR
miRNA Stemloop ID	miR-1	miRNA Mature ID	miR-1-3p
miRNA Sequence	UGGAAUGUAAAGAAGUAUGUAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-129 directly targets ABCB1			[ 36 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay//qRT-PCR//Western blot
miRNA Stemloop ID	miR-129	miRNA Mature ID	miR-129-5p
miRNA Sequence	CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	miR-186 directly targets ABCB1			[ 38 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
miRNA Stemloop ID	miR-186	miRNA Mature ID	miR-186-5p
miRNA Sequence	CAAAGAAUUCUCCUUUUGGGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-223 directly targets ABCB1			[ 40 ]
Epigenetic Type	microRNA	Experiment Method	GFP reporter assay//qRT-PCR//Western blot
miRNA Stemloop ID	miR-223	miRNA Mature ID	miR-223-3p
miRNA Sequence	UGUCAGUUUGUCAAAUACCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-491 directly targets ABCB1			[ 43 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay//qRT-PCR//Western blot
miRNA Stemloop ID	miR-491	miRNA Mature ID	miR-491-3p
miRNA Sequence	CUUAUGCAAGAUUCCCUUCUAC
miRNA Target Type	Direct
Experimental Material	Human epithelial colorectal adenocarcinoma cell line(Caco-2)
Epigenetic Phenomenon 6	miR-508 directly targets ABCB1			[ 41 ]
Epigenetic Type	microRNA	Experiment Method	Immunohistochemistry//In situ hybridization//Luciferase reporter assay//Microarray//qRT-PCR//Western blot
miRNA Stemloop ID	miR-508	miRNA Mature ID	miR-508-5p
miRNA Sequence	UACUCCAGAGGGCGUCACUCAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-9 directly targets ABCB1			[ 42 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
miRNA Stemloop ID	miR-9	miRNA Mature ID	miR-9-3p
miRNA Sequence	AUAAAGCUAGAUAACCGAAAGU
miRNA Target Type	Direct
Experimental Material	Patient tissue samples, Multiple cell lines of human

References
1	Up-regulation of ABCB1/P-glycoprotein by escaping promoter hypermethylation indicates poor prognosis in hematologic malignancy patients with and without bone marrow transplantation. Leuk Res. 2011 Jan;35(1):73-9.
2	CpG hypomethylation of MDR1 gene in tumor and serum of invasive ductal breast carcinoma patients. Clin Biochem. 2010 Mar;43(4-5):373-9.
3	Hypermethylation of ATP-binding cassette B1 (ABCB1) multidrug resistance 1 (MDR1) is associated with cisplatin resistance in the A549 lung adenocarcinoma cell line. Int J Exp Pathol. 2016 Dec;97(6):412-421.
4	Influence of MDR1 methylation on the curative effect of interventional embolism chemotherapy for cervical cancer. Ther Clin Risk Manag. 2016 Feb 15;12:217-23.
5	Genetic and epigenetic changes in host ABCB1 influences malaria susceptibility to Plasmodium falciparum. PLoS One. 2017 Apr 19;12(4):e0175702.
6	Expression and promoter methylation analysis of ATP-binding cassette genes in pancreatic cancer. Oncol Rep. 2012 Jan;27(1):265-9.
7	DNA methylation patterns at relapse in adult acute lymphocytic leukemia. Clin Cancer Res. 2002 Jun;8(6):1897-903.
8	DNA methylation profiling in doxorubicin treated primary locally advanced breast tumours identifies novel genes associated with survival and treatment response. Mol Cancer. 2010 Mar 25;9:68.
9	Promoter methylation patterns of ABCB1, ABCC1 and ABCG2 in human cancer cell lines, multidrug-resistant cell models and tumor, tumor-adjacent and tumor-distant tissues from breast cancer patients. Oncotarget. 2016 Nov 8;7(45):73347-73369.
10	Frequent aberrant DNA methylation of ABCB1, FOXC1, PPP2R2B and PTEN in ductal carcinoma in situ and early invasive breast cancer. Breast Cancer Res. 2010;12(1):R3.
11	Frequent down-regulation of ABC transporter genes in prostate cancer. BMC Cancer. 2015 Oct 12;15:683.
12	MDR1 promoter hypermethylation in MCF-7 human breast cancer cells: changes in chromatin structure induced by treatment with 5-Aza-cytidine. Cancer Biol Ther. 2004 Jun;3(6):540-8.
13	Newborn blood DNA epigenetic variations and signaling pathway genes associated with Tetralogy of Fallot (TOF). PLoS One. 2018 Sep 13;13(9):e0203893.
14	Epigenetic modulation of the drug resistance genes MGMT, ABCB1 and ABCG2 in glioblastoma multiforme. BMC Cancer. 2013 Dec 31;13:617.
15	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
16	DNA Methylation Dynamics in Urological Tumors.
17	Genome-wide Scan for Methylation Profiles in Breast Cancer
18	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
19	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
20	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
21	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
22	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
23	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
24	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
25	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
26	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
27	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
28	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
29	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
30	Histone deacetylase inhibitors induce a very broad, pleiotropic anticancer drug resistance phenotype in acute myeloid leukemia cells by modulation of multiple ABC transporter genes. Clin Cancer Res. 2009 Jun 1;15(11):3705-15.
31	Elevated level of lysine 9-acetylated histone H3 at the MDR1 promoter in multidrug-resistant cells. Cancer Sci. 2012 Apr;103(4):659-69.
32	Epigenetic regulation of the ABCB1 gene in drug-sensitive and drug-resistant lymphoid tumour cell lines obtained from canine patients. Vet J. 2014 Jan;199(1):103-9.
33	Genetic and epigenetic modeling of the origins of multidrug-resistant cells in a human sarcoma cell line. Cancer Res. 2005 Oct 15;65(20):9388-97.
34	The histone deacetylase inhibitor trichostatin A downregulates human MDR1 (ABCB1) gene expression by a transcription-dependent mechanism in a drug-resistant small cell lung carcinoma cell line model. Br J Cancer. 2007 Aug 20;97(4):562-73.
35	Salinomycin overcomes ABC transporter-mediated multidrug and apoptosis resistance in human leukemia stem cell-like KG-1a cells. Biochem Biophys Res Commun. 2010 Apr 16;394(4):1098-104.
36	MiR-129 regulates cisplatin-resistance in human gastric cancer cells by targeting P-gp. Biomed Pharmacother. 2017 Feb;86:450-456.
37	miR-137 restoration sensitizes multidrug-resistant MCF-7/ADM cells to anticancer agents by targeting YB-1. Acta Biochim Biophys Sin (Shanghai). 2013 Feb;45(2):80-6.
38	MicroRNA-186 induces sensitivity of ovarian cancer cells to paclitaxel and cisplatin by targeting ABCB1. J Ovarian Res. 2015 Dec 2;8:80.
39	Decreased expression of microRNA-214 contributes to imatinib mesylate resistance of chronic myeloid leukemia patients by upregulating ABCB1 gene expression. Exp Ther Med. 2018 Sep;16(3):1693-1700.
40	MiR-223 modulates multidrug resistance via downregulation of ABCB1 in hepatocellular carcinoma cells. Exp Biol Med (Maywood). 2013 Sep;238(9):1024-32.
41	miR-508-5p regulates multidrug resistance of gastric cancer by targeting ABCB1 and ZNRD1. Oncogene. 2014 Jun 19;33(25):3267-76.
42	miR-9 regulates the multidrug resistance of chronic myelogenous leukemia by targeting ABCB1. Oncol Rep. 2017 Apr;37(4):2193-2200.
43	Atorvastatin attenuation of ABCB1 expression is mediated by microRNA miR-491-3p in Caco-2 cells. Eur J Pharm Sci. 2016 Oct 10;93:431-6.
44	The PI3K/mTOR dual inhibitor BEZ235 suppresses proliferation and migration and reverses multidrug resistance in acute myeloid leukemia. Acta Pharmacol Sin. 2017 Mar;38(3):382-391.
45	Methylation of miR-129-5p CpG island modulates multi-drug resistance in gastric cancer by targeting ABC transporters. Oncotarget. 2014 Nov 30;5(22):11552-63.
46	Genetic and epigenetic similarities and differences between childhood and adult AML. Pediatr Blood Cancer. 2012 Apr;58(4):525-31.
47	Quantitative analysis of cancer-associated gene methylation connected to risk factors in Korean colorectal cancer patients. J Prev Med Public Health. 2012 Jul;45(4):251-8.
48	Effect of promoter methylation of multidrug resistance 1 (MDR1) gene in gastric carcinogenesis. Anticancer Res. 2009 Jan;29(1):337-41.
49	RASSF1A, APC, ESR1, ABCB1 and HOXC9, but not p16INK4A, DAPK1, PTEN and MT1G genes were frequently methylated in the stage I non-small cell lung cancer in China. J Cancer Res Clin Oncol. 2009 Dec;135(12):1675-84.
50	Association of ABCB1 promoter methylation with aspirin exposure, platelet function, and clinical outcomes in Chinese intracranial artery stenosis patients. Eur J Clin Pharmacol. 2017 Oct;73(10):1261-1269.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence