Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0021 Transporter Info
Gene Name	SLC15A1
Transporter Name	Peptide transporter 1
Gene ID	6564
UniProt ID	P46059

Epigenetic Regulations of This DT (EGR)
Methylation
Colon cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in colon adenocarcinoma			[ 1 ]
Location	5'UTR (cg24766398)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 4.18E-04; Z-score: -1.25E+00
Methylation in Case	5.15E-01 (Median)	Methylation in Control	5.88E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in colon adenocarcinoma			[ 1 ]
Location	TSS1500 (cg19024632)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.60E+00	Statistic Test	p-value: 3.60E-04; Z-score: 2.60E+00
Methylation in Case	3.88E-01 (Median)	Methylation in Control	2.42E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC15A1 in colon adenocarcinoma			[ 1 ]
Location	TSS1500 (cg18494399)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.41E+00	Statistic Test	p-value: 1.24E-03; Z-score: 1.98E+00
Methylation in Case	1.19E-01 (Median)	Methylation in Control	4.92E-02 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC15A1 in colon adenocarcinoma			[ 1 ]
Location	Body (cg25966649)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.71E-03; Z-score: -1.98E+00
Methylation in Case	7.70E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC15A1 in colon adenocarcinoma			[ 1 ]
Location	Body (cg11624345)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 2.18E-03; Z-score: 1.44E+00
Methylation in Case	5.97E-01 (Median)	Methylation in Control	5.42E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	5'UTR (cg07766263)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.42E+00	Statistic Test	p-value: 1.97E-21; Z-score: 3.31E+00
Methylation in Case	5.89E-01 (Median)	Methylation in Control	4.16E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	5'UTR (cg18405360)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 9.67E-04; Z-score: 5.69E-01
Methylation in Case	6.63E-02 (Median)	Methylation in Control	6.12E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg12869058)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 2.12E-13; Z-score: -2.14E+00
Methylation in Case	6.07E-01 (Median)	Methylation in Control	7.25E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg17306747)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.89E+00	Statistic Test	p-value: 1.52E-06; Z-score: 1.61E+00
Methylation in Case	5.09E-01 (Median)	Methylation in Control	2.70E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg11262462)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 5.04E-05; Z-score: 1.54E+00
Methylation in Case	7.44E-01 (Median)	Methylation in Control	6.61E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg10131887)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 3.85E-02; Z-score: -2.76E-01
Methylation in Case	5.49E-02 (Median)	Methylation in Control	5.88E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS200 (cg14066757)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.78E+00	Statistic Test	p-value: 9.57E-14; Z-score: -2.64E+00
Methylation in Case	2.54E-01 (Median)	Methylation in Control	4.54E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS200 (cg15114105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.83E-03; Z-score: -1.59E-01
Methylation in Case	5.83E-02 (Median)	Methylation in Control	6.29E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	1stExon (cg27016990)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+01	Statistic Test	p-value: 2.21E-32; Z-score: 1.59E+01
Methylation in Case	2.81E-01 (Median)	Methylation in Control	2.33E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg14084826)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 5.06E-27; Z-score: -5.38E+00
Methylation in Case	6.54E-01 (Median)	Methylation in Control	7.58E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg20632573)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 3.87E-09; Z-score: 1.43E+00
Methylation in Case	2.31E-01 (Median)	Methylation in Control	1.60E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg14479094)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 2.68E-08; Z-score: -1.35E+00
Methylation in Case	8.35E-01 (Median)	Methylation in Control	8.74E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg10616300)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.01E+00	Statistic Test	p-value: 9.52E-08; Z-score: -1.59E+00
Methylation in Case	1.22E-01 (Median)	Methylation in Control	2.45E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC15A1 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg16555556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.24E-05; Z-score: 1.19E+00
Methylation in Case	5.15E-01 (Median)	Methylation in Control	4.33E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in bladder cancer			[ 3 ]
Location	TSS1500 (cg12824139)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 6.25E-03; Z-score: -3.85E+00
Methylation in Case	6.78E-01 (Median)	Methylation in Control	7.53E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in bladder cancer			[ 3 ]
Location	TSS200 (cg08390696)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 3.69E-03; Z-score: -3.24E+00
Methylation in Case	2.49E-01 (Median)	Methylation in Control	3.03E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC15A1 in bladder cancer			[ 3 ]
Location	Body (cg12355681)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.33E+00	Statistic Test	p-value: 2.27E-05; Z-score: -4.75E+00
Methylation in Case	8.53E-02 (Median)	Methylation in Control	1.98E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC15A1 in bladder cancer			[ 3 ]
Location	Body (cg17410857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.29E-02; Z-score: -1.85E+00
Methylation in Case	8.90E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC15A1 in bladder cancer			[ 3 ]
Location	Body (cg05621157)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 2.13E-02; Z-score: -1.43E+00
Methylation in Case	8.36E-02 (Median)	Methylation in Control	1.15E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC15A1 in bladder cancer			[ 3 ]
Location	Body (cg03648690)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.86E-02; Z-score: -1.36E+00
Methylation in Case	9.67E-01 (Median)	Methylation in Control	9.72E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC15A1 in bladder cancer			[ 3 ]
Location	3'UTR (cg02319149)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.54E+00	Statistic Test	p-value: 5.18E-09; Z-score: -7.52E+00
Methylation in Case	5.24E-01 (Median)	Methylation in Control	8.10E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	TSS1500 (cg20731581)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.04E-06; Z-score: 8.96E-01
Methylation in Case	7.00E-01 (Median)	Methylation in Control	6.29E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	TSS1500 (cg12824139)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 8.99E-04; Z-score: 6.72E-01
Methylation in Case	7.22E-01 (Median)	Methylation in Control	6.48E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	TSS200 (cg08390696)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 1.23E-05; Z-score: 1.42E+00
Methylation in Case	3.62E-01 (Median)	Methylation in Control	2.92E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	TSS200 (cg18153630)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.41E+00	Statistic Test	p-value: 2.28E-05; Z-score: 1.37E+00
Methylation in Case	2.21E-01 (Median)	Methylation in Control	1.56E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	TSS200 (cg18478319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.64E+00	Statistic Test	p-value: 3.87E-05; Z-score: 8.69E-01
Methylation in Case	1.11E-01 (Median)	Methylation in Control	6.75E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	Body (cg10694152)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.45E+00	Statistic Test	p-value: 7.92E-08; Z-score: 1.75E+00
Methylation in Case	1.58E-01 (Median)	Methylation in Control	1.08E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	Body (cg05621157)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 1.08E-07; Z-score: 1.13E+00
Methylation in Case	1.51E-01 (Median)	Methylation in Control	1.18E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	Body (cg13917287)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.91E-07; Z-score: -1.27E+00
Methylation in Case	7.43E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	Body (cg08799967)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 1.27E-06; Z-score: -1.50E+00
Methylation in Case	6.56E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	Body (cg17410857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.53E-04; Z-score: -1.09E+00
Methylation in Case	8.44E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	Body (cg20568691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 4.20E-04; Z-score: 1.09E+00
Methylation in Case	7.08E-01 (Median)	Methylation in Control	6.06E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	Body (cg12355681)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 5.40E-03; Z-score: 1.20E-01
Methylation in Case	1.92E-01 (Median)	Methylation in Control	1.87E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	Body (cg02528196)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 9.03E-03; Z-score: -4.12E-01
Methylation in Case	8.66E-01 (Median)	Methylation in Control	8.74E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC15A1 in breast cancer			[ 4 ]
Location	3'UTR (cg02319149)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 2.12E-08; Z-score: -1.88E+00
Methylation in Case	8.38E-01 (Median)	Methylation in Control	8.82E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg20731581)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.13E-02; Z-score: -7.14E-02
Methylation in Case	9.30E-01 (Median)	Methylation in Control	9.31E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS200 (cg18478319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.61E+00	Statistic Test	p-value: 2.53E-03; Z-score: 7.79E-01
Methylation in Case	6.48E-02 (Median)	Methylation in Control	4.02E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC15A1 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS200 (cg18153630)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 8.04E-03; Z-score: 8.96E-01
Methylation in Case	1.56E-01 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC15A1 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg05621157)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 2.04E-03; Z-score: 5.60E-01
Methylation in Case	5.57E-02 (Median)	Methylation in Control	4.89E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC15A1 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg10694152)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 1.46E-02; Z-score: 4.54E-01
Methylation in Case	6.90E-02 (Median)	Methylation in Control	5.36E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg12824139)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 3.16E-02; Z-score: 9.73E-01
Methylation in Case	8.87E-01 (Median)	Methylation in Control	8.58E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg18478319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 1.44E-04; Z-score: 4.07E-01
Methylation in Case	1.04E-01 (Median)	Methylation in Control	8.91E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC15A1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg18153630)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 7.17E-03; Z-score: 4.79E-02
Methylation in Case	2.88E-01 (Median)	Methylation in Control	2.85E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC15A1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg08390696)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 9.57E-03; Z-score: 7.84E-01
Methylation in Case	5.51E-01 (Median)	Methylation in Control	5.01E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC15A1 in colorectal cancer			[ 6 ]
Location	Body (cg08799967)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.95E-08; Z-score: -2.23E+00
Methylation in Case	8.40E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC15A1 in colorectal cancer			[ 6 ]
Location	Body (cg10694152)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 2.69E-05; Z-score: 7.94E-01
Methylation in Case	2.53E-01 (Median)	Methylation in Control	2.06E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC15A1 in colorectal cancer			[ 6 ]
Location	Body (cg02528196)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.86E-03; Z-score: -6.10E-01
Methylation in Case	9.47E-01 (Median)	Methylation in Control	9.55E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC15A1 in colorectal cancer			[ 6 ]
Location	Body (cg13917287)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.79E-03; Z-score: -4.06E-01
Methylation in Case	8.78E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC15A1 in colorectal cancer			[ 6 ]
Location	Body (cg05621157)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 6.29E-03; Z-score: 5.18E-01
Methylation in Case	2.44E-01 (Median)	Methylation in Control	2.04E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC15A1 in colorectal cancer			[ 6 ]
Location	Body (cg17410857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 3.35E-02; Z-score: -4.03E-01
Methylation in Case	9.45E-01 (Median)	Methylation in Control	9.49E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg16406186)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.84E+00	Statistic Test	p-value: 5.98E-15; Z-score: -2.98E+00
Methylation in Case	2.92E-01 (Median)	Methylation in Control	5.38E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg03963113)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 4.11E-14; Z-score: -4.48E+00
Methylation in Case	4.96E-01 (Median)	Methylation in Control	6.58E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC15A1 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg02701825)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.37E+00	Statistic Test	p-value: 6.22E-12; Z-score: 2.93E+00
Methylation in Case	5.96E-01 (Median)	Methylation in Control	4.34E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC15A1 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg20731581)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.73E-03; Z-score: -4.89E-01
Methylation in Case	7.88E-01 (Median)	Methylation in Control	8.00E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC15A1 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg12824139)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 2.38E-02; Z-score: 8.71E-03
Methylation in Case	7.91E-01 (Median)	Methylation in Control	7.91E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC15A1 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg18478319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.62E+00	Statistic Test	p-value: 5.01E-06; Z-score: -8.71E-01
Methylation in Case	8.03E-02 (Median)	Methylation in Control	1.30E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC15A1 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg18153630)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 1.15E-05; Z-score: -1.18E+00
Methylation in Case	1.57E-01 (Median)	Methylation in Control	2.06E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC15A1 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg08390696)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 6.40E-05; Z-score: -1.14E+00
Methylation in Case	2.95E-01 (Median)	Methylation in Control	3.63E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC15A1 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg00588853)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.43E+00	Statistic Test	p-value: 2.13E-18; Z-score: 5.89E+00
Methylation in Case	4.75E-01 (Median)	Methylation in Control	1.95E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC15A1 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg16849860)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 1.96E-10; Z-score: -2.27E+00
Methylation in Case	6.58E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC15A1 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg05621157)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 2.69E-02; Z-score: -3.97E-01
Methylation in Case	1.10E-01 (Median)	Methylation in Control	1.20E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC15A1 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg12355681)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 3.64E-02; Z-score: 8.09E-02
Methylation in Case	1.29E-01 (Median)	Methylation in Control	1.26E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC15A1 in hepatocellular carcinoma			[ 7 ]
Location	3'UTR (cg02319149)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.65E-02; Z-score: -2.05E-01
Methylation in Case	8.54E-01 (Median)	Methylation in Control	8.58E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in HIV infection			[ 8 ]
Location	TSS1500 (cg20731581)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 6.86E-03; Z-score: -8.10E-01
Methylation in Case	7.85E-01 (Median)	Methylation in Control	8.18E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in HIV infection			[ 8 ]
Location	TSS200 (cg18478319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.72E+00	Statistic Test	p-value: 1.13E-05; Z-score: 1.82E+00
Methylation in Case	2.18E-01 (Median)	Methylation in Control	1.26E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC15A1 in HIV infection			[ 8 ]
Location	TSS200 (cg08390696)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 1.49E-05; Z-score: 1.39E+00
Methylation in Case	4.34E-01 (Median)	Methylation in Control	3.72E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC15A1 in HIV infection			[ 8 ]
Location	TSS200 (cg18153630)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 1.92E-05; Z-score: 1.88E+00
Methylation in Case	2.86E-01 (Median)	Methylation in Control	2.21E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC15A1 in HIV infection			[ 8 ]
Location	Body (cg13917287)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 2.59E-07; Z-score: -2.92E+00
Methylation in Case	7.49E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC15A1 in HIV infection			[ 8 ]
Location	Body (cg10694152)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 2.44E-04; Z-score: 1.40E+00
Methylation in Case	1.55E-01 (Median)	Methylation in Control	1.21E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC15A1 in HIV infection			[ 8 ]
Location	Body (cg05621157)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 3.13E-04; Z-score: 9.17E-01
Methylation in Case	1.53E-01 (Median)	Methylation in Control	1.32E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC15A1 in HIV infection			[ 8 ]
Location	Body (cg02528196)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 1.39E-02; Z-score: 7.32E-01
Methylation in Case	9.40E-01 (Median)	Methylation in Control	9.29E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC15A1 in HIV infection			[ 8 ]
Location	Body (cg12355681)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 2.41E-02; Z-score: 4.98E-01
Methylation in Case	1.53E-01 (Median)	Methylation in Control	1.32E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC15A1 in HIV infection			[ 8 ]
Location	Body (cg08799967)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.90E-02; Z-score: -5.95E-01
Methylation in Case	7.95E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Prostate cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in prostate cancer			[ 9 ]
Location	TSS1500 (cg20259557)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 4.33E-02; Z-score: 1.81E+00
Methylation in Case	9.02E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in lung adenocarcinoma			[ 10 ]
Location	TSS200 (cg18478319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.55E+00	Statistic Test	p-value: 3.87E-03; Z-score: 2.86E+00
Methylation in Case	2.42E-01 (Median)	Methylation in Control	1.56E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in lung adenocarcinoma			[ 10 ]
Location	TSS200 (cg18153630)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 1.09E-02; Z-score: 1.81E+00
Methylation in Case	2.96E-01 (Median)	Methylation in Control	2.55E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC15A1 in lung adenocarcinoma			[ 10 ]
Location	TSS200 (cg08390696)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 2.70E-02; Z-score: 1.30E+00
Methylation in Case	4.33E-01 (Median)	Methylation in Control	3.84E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC15A1 in lung adenocarcinoma			[ 10 ]
Location	Body (cg13917287)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 5.16E-04; Z-score: -7.34E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	8.39E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC15A1 in lung adenocarcinoma			[ 10 ]
Location	Body (cg08799967)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.42E-02; Z-score: -1.48E+00
Methylation in Case	7.84E-01 (Median)	Methylation in Control	8.24E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC15A1 in lung adenocarcinoma			[ 10 ]
Location	Body (cg10694152)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 3.97E-02; Z-score: 1.36E+00
Methylation in Case	2.31E-01 (Median)	Methylation in Control	1.70E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in panic disorder			[ 11 ]
Location	TSS200 (cg18153630)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.39E-01	Statistic Test	p-value: 2.42E-02; Z-score: -4.19E-01
Methylation in Case	-2.56E+00 (Median)	Methylation in Control	-2.41E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in panic disorder			[ 11 ]
Location	TSS200 (cg18478319)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.01E-01	Statistic Test	p-value: 4.60E-02; Z-score: -3.44E-01
Methylation in Case	-3.96E+00 (Median)	Methylation in Control	-3.57E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC15A1 in panic disorder			[ 11 ]
Location	Body (cg20568691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.43E+00	Statistic Test	p-value: 3.50E-02; Z-score: 5.19E-01
Methylation in Case	6.99E-01 (Median)	Methylation in Control	4.90E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC15A1 in panic disorder			[ 11 ]
Location	Body (cg05621157)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.69E-01	Statistic Test	p-value: 4.21E-02; Z-score: -2.26E-01
Methylation in Case	-3.72E+00 (Median)	Methylation in Control	-3.60E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg02528196)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 1.72E-04; Z-score: 1.31E+00
Methylation in Case	8.26E-01 (Median)	Methylation in Control	7.02E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg03648690)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 3.97E-04; Z-score: -8.50E-01
Methylation in Case	7.84E-01 (Median)	Methylation in Control	8.35E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC15A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg05621157)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.35E+00	Statistic Test	p-value: 1.55E-03; Z-score: -5.89E-01
Methylation in Case	6.32E-02 (Median)	Methylation in Control	1.48E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC15A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg08799967)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 7.98E-03; Z-score: 6.33E-01
Methylation in Case	8.39E-01 (Median)	Methylation in Control	7.60E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC15A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg10694152)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.73E-02; Z-score: 5.70E-01
Methylation in Case	8.62E-01 (Median)	Methylation in Control	8.24E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC15A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg12355681)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 2.70E-02; Z-score: 4.11E-01
Methylation in Case	2.20E-02 (Median)	Methylation in Control	1.91E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC15A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg13917287)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.97E-02; Z-score: 4.50E-01
Methylation in Case	8.12E-01 (Median)	Methylation in Control	7.65E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC15A1 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	3'UTR (cg02319149)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 1.84E-15; Z-score: -2.49E+00
Methylation in Case	6.09E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Depression	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in depression			[ 13 ]
Location	Body (cg05621157)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 3.61E-02; Z-score: 1.94E-01
Methylation in Case	1.03E-01 (Median)	Methylation in Control	1.00E-01 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in depression			[ 13 ]
Location	Body (cg08799967)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.76E-02; Z-score: -4.59E-01
Methylation in Case	7.37E-01 (Median)	Methylation in Control	7.47E-01 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in papillary thyroid cancer			[ 14 ]
Location	Body (cg08799967)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 8.83E-07; Z-score: -1.33E+00
Methylation in Case	8.53E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in papillary thyroid cancer			[ 14 ]
Location	Body (cg20568691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 2.38E-05; Z-score: 1.28E+00
Methylation in Case	6.07E-01 (Median)	Methylation in Control	5.03E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC15A1 in papillary thyroid cancer			[ 14 ]
Location	Body (cg13917287)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.63E-02; Z-score: -2.04E-01
Methylation in Case	9.11E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC15A1 in papillary thyroid cancer			[ 14 ]
Location	Body (cg17410857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.98E-02; Z-score: -4.67E-01
Methylation in Case	9.39E-01 (Median)	Methylation in Control	9.44E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC15A1 in systemic lupus erythematosus			[ 15 ]
Location	Body (cg02528196)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.18E-02; Z-score: -2.82E-01
Methylation in Case	9.26E-01 (Median)	Methylation in Control	9.32E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC15A1 in systemic lupus erythematosus			[ 15 ]
Location	Body (cg08799967)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.58E-02; Z-score: -3.21E-01
Methylation in Case	8.05E-01 (Median)	Methylation in Control	8.26E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC15A1 in systemic lupus erythematosus			[ 15 ]
Location	3'UTR (cg02319149)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.44E-02; Z-score: -2.67E-01
Methylation in Case	9.10E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Malignant astrocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC15A1 in malignant astrocytoma than that in healthy individual
Studied Phenotype	Malignant astrocytoma [ICD-11:2A00.12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 4.53E-32; Fold-change: 0.212337943; Z-score: 1.536471879
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC15A1 in oligodendroglioma than that in healthy individual
Studied Phenotype	Oligodendroglioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 9.23E-15; Fold-change: 0.228412805; Z-score: 1.315669216
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Glioblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC15A1 in glioblastoma than that in healthy individual
Studied Phenotype	Glioblastoma [ICD-11:2A00.00]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.62E-06; Fold-change: 0.344391807; Z-score: 1.419947045
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC15A1 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 5.86E-32; Fold-change: 0.539411336; Z-score: 3.107036353
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Gastric cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC15A1 in gastric cancer than that in adjacent tissue
Studied Phenotype	Gastric cancer [ICD-11:2B72]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 1.92E-06; Fold-change: 0.277201307; Z-score: 15.44108895
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	17 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1827 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1827	miRNA Mature ID	miR-1827
miRNA Sequence	UGAGGCAGUAGAUUGAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-3929 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3929	miRNA Mature ID	miR-3929
miRNA Sequence	GAGGCUGAUGUGAGUAGACCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-4478 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4478	miRNA Mature ID	miR-4478
miRNA Sequence	GAGGCUGAGCUGAGGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-4649 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4649	miRNA Mature ID	miR-4649-3p
miRNA Sequence	UCUGAGGCCUGCCUCUCCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-4691 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4691	miRNA Mature ID	miR-4691-3p
miRNA Sequence	CCAGCCACGGACUGAGAGUGCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-4722 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4722	miRNA Mature ID	miR-4722-5p
miRNA Sequence	GGCAGGAGGGCUGUGCCAGGUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-4768 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4768	miRNA Mature ID	miR-4768-3p
miRNA Sequence	CCAGGAGAUCCAGAGAGAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-485 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-485	miRNA Mature ID	miR-485-5p
miRNA Sequence	AGAGGCUGGCCGUGAUGAAUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-665 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-665	miRNA Mature ID	miR-665
miRNA Sequence	ACCAGGAGGCUGAGGCCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-6746 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6746	miRNA Mature ID	miR-6746-5p
miRNA Sequence	CCGGGAGAAGGAGGUGGCCUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-6771 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6771	miRNA Mature ID	miR-6771-5p
miRNA Sequence	CUCGGGAGGGCAUGGGCCAGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-6808 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6808	miRNA Mature ID	miR-6808-5p
miRNA Sequence	CAGGCAGGGAGGUGGGACCAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-6884 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6884	miRNA Mature ID	miR-6884-5p
miRNA Sequence	AGAGGCUGAGAAGGUGAUGUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-6893 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6893	miRNA Mature ID	miR-6893-5p
miRNA Sequence	CAGGCAGGUGUAGGGUGGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-7160 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7160	miRNA Mature ID	miR-7160-5p
miRNA Sequence	UGCUGAGGUCCGGGCUGUGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-7977 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7977	miRNA Mature ID	miR-7977
miRNA Sequence	UUCCCAGCCAACGCACCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-940 directly targets SLC15A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-940	miRNA Mature ID	miR-940
miRNA Sequence	AAGGCAGGGCCCCCGCUCCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3	DNA Methylation Dynamics in Urological Tumors.
4	Genome-wide Scan for Methylation Profiles in Breast Cancer
5	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
14	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
15	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
16	Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence