Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0152 Transporter Info
Gene Name	SLC22A9
Transporter Name	Organic anion transporter 7
Gene ID	114571
UniProt ID	Q8IVM8

Epigenetic Regulations of This DT (EGR)
Methylation
Bladder cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A9 in bladder cancer			[ 1 ]
Location	TSS1500 (cg22995232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.67E+00	Statistic Test	p-value: 2.43E-11; Z-score: -1.07E+01
Methylation in Case	4.36E-01 (Median)	Methylation in Control	7.29E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A9 in bladder cancer			[ 1 ]
Location	TSS200 (cg07751764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.41E+00	Statistic Test	p-value: 5.51E-14; Z-score: -1.53E+01
Methylation in Case	3.16E-01 (Median)	Methylation in Control	7.60E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A9 in bladder cancer			[ 1 ]
Location	TSS200 (cg23683201)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.01E+00	Statistic Test	p-value: 1.14E-12; Z-score: -3.75E+01
Methylation in Case	3.88E-01 (Median)	Methylation in Control	7.82E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A9 in breast cancer			[ 2 ]
Location	TSS1500 (cg22995232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 4.45E-02; Z-score: -4.27E-01
Methylation in Case	6.21E-01 (Median)	Methylation in Control	6.46E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A9 in breast cancer			[ 2 ]
Location	TSS200 (cg07751764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 8.20E-06; Z-score: -1.05E+00
Methylation in Case	6.21E-01 (Median)	Methylation in Control	6.99E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A9 in breast cancer			[ 2 ]
Location	TSS200 (cg23683201)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 3.50E-02; Z-score: 4.08E-01
Methylation in Case	8.18E-01 (Median)	Methylation in Control	8.00E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A9 in breast cancer			[ 2 ]
Location	3'UTR (cg02165693)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.41E-04; Z-score: -9.65E-01
Methylation in Case	8.85E-01 (Median)	Methylation in Control	9.03E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A9 in hepatocellular carcinoma			[ 3 ]
Location	TSS1500 (cg22995232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 2.11E-07; Z-score: -1.63E+00
Methylation in Case	3.22E-01 (Median)	Methylation in Control	4.51E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A9 in hepatocellular carcinoma			[ 3 ]
Location	TSS1500 (cg05133251)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 5.37E-03; Z-score: -4.33E-01
Methylation in Case	8.78E-01 (Median)	Methylation in Control	8.84E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A9 in hepatocellular carcinoma			[ 3 ]
Location	TSS200 (cg23683201)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 8.59E-09; Z-score: -1.44E+00
Methylation in Case	4.76E-01 (Median)	Methylation in Control	6.23E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A9 in hepatocellular carcinoma			[ 3 ]
Location	1stExon (cg01135800)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.41E+00	Statistic Test	p-value: 5.94E-06; Z-score: -1.46E+00
Methylation in Case	3.20E-01 (Median)	Methylation in Control	4.52E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A9 in hepatocellular carcinoma			[ 3 ]
Location	Body (cg21212995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 2.45E-11; Z-score: 4.12E+00
Methylation in Case	4.91E-01 (Median)	Methylation in Control	3.52E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A9 in hepatocellular carcinoma			[ 3 ]
Location	Body (cg10116443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 2.00E-03; Z-score: -4.46E-02
Methylation in Case	8.16E-01 (Median)	Methylation in Control	8.18E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A9 in hepatocellular carcinoma			[ 3 ]
Location	3'UTR (cg06219125)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+00	Statistic Test	p-value: 1.16E-18; Z-score: -6.30E+00
Methylation in Case	5.09E-01 (Median)	Methylation in Control	7.87E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A9 in HIV infection			[ 4 ]
Location	TSS1500 (cg22995232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.47E-02; Z-score: -6.79E-01
Methylation in Case	8.18E-01 (Median)	Methylation in Control	8.45E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A9 in HIV infection			[ 4 ]
Location	TSS1500 (cg05133251)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.59E-02; Z-score: -5.63E-01
Methylation in Case	9.20E-01 (Median)	Methylation in Control	9.29E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A9 in HIV infection			[ 4 ]
Location	1stExon (cg01135800)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 3.51E-04; Z-score: -1.42E+00
Methylation in Case	8.04E-01 (Median)	Methylation in Control	8.44E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A9 in HIV infection			[ 4 ]
Location	Body (cg10116443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 5.06E-03; Z-score: -1.61E+00
Methylation in Case	8.64E-01 (Median)	Methylation in Control	9.03E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A9 in pancretic ductal adenocarcinoma			[ 5 ]
Location	TSS1500 (cg05863502)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.09E+00	Statistic Test	p-value: 1.11E-09; Z-score: 2.02E+00
Methylation in Case	5.44E-01 (Median)	Methylation in Control	2.60E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A9 in pancretic ductal adenocarcinoma			[ 5 ]
Location	TSS200 (cg14549755)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 3.10E-02; Z-score: -4.59E-01
Methylation in Case	5.13E-02 (Median)	Methylation in Control	5.58E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A9 in pancretic ductal adenocarcinoma			[ 5 ]
Location	Body (cg07696884)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 1.51E-02; Z-score: 4.04E-01
Methylation in Case	8.74E-01 (Median)	Methylation in Control	8.66E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A9 in pancretic ductal adenocarcinoma			[ 5 ]
Location	Body (cg10375016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 2.14E-02; Z-score: 1.11E-01
Methylation in Case	8.97E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A9 in pancretic ductal adenocarcinoma			[ 5 ]
Location	3'UTR (cg02319149)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 1.24E-06; Z-score: 1.61E+00
Methylation in Case	8.15E-01 (Median)	Methylation in Control	6.08E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A9 in papillary thyroid cancer			[ 6 ]
Location	TSS1500 (cg22995232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.18E-03; Z-score: -9.22E-01
Methylation in Case	6.08E-01 (Median)	Methylation in Control	6.71E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A9 in papillary thyroid cancer			[ 6 ]
Location	1stExon (cg01135800)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 4.50E-03; Z-score: -9.62E-01
Methylation in Case	5.70E-01 (Median)	Methylation in Control	6.27E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A9 in papillary thyroid cancer			[ 6 ]
Location	Body (cg10116443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 7.70E-04; Z-score: -4.92E-01
Methylation in Case	8.77E-01 (Median)	Methylation in Control	8.92E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A9 in papillary thyroid cancer			[ 6 ]
Location	3'UTR (cg02165693)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 7.87E-03; Z-score: -5.19E-01
Methylation in Case	9.43E-01 (Median)	Methylation in Control	9.50E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A9 in lung adenocarcinoma			[ 7 ]
Location	TSS200 (cg23683201)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 3.44E-03; Z-score: 1.72E+00
Methylation in Case	8.24E-01 (Median)	Methylation in Control	7.45E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A9 in lung adenocarcinoma			[ 7 ]
Location	1stExon (cg01135800)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.11E-02; Z-score: -1.09E+00
Methylation in Case	7.20E-01 (Median)	Methylation in Control	7.63E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A9 in lung adenocarcinoma			[ 7 ]
Location	Body (cg10116443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.51E-04; Z-score: -2.28E+00
Methylation in Case	7.90E-01 (Median)	Methylation in Control	8.57E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A9 in systemic lupus erythematosus			[ 8 ]
Location	TSS200 (cg23683201)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 3.32E-02; Z-score: -1.29E-01
Methylation in Case	9.25E-01 (Median)	Methylation in Control	9.27E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A9 in systemic lupus erythematosus			[ 8 ]
Location	1stExon (cg01135800)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.60E-02; Z-score: -2.37E-01
Methylation in Case	8.04E-01 (Median)	Methylation in Control	8.19E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A9 in systemic lupus erythematosus			[ 8 ]
Location	Body (cg10116443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.44E-02; Z-score: -1.67E-01
Methylation in Case	8.53E-01 (Median)	Methylation in Control	8.64E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A9 in atypical teratoid rhabdoid tumor			[ 9 ]
Location	1stExon (cg01135800)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.58E+00	Statistic Test	p-value: 6.92E-29; Z-score: -4.09E+00
Methylation in Case	5.30E-01 (Median)	Methylation in Control	8.35E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A9 in atypical teratoid rhabdoid tumor			[ 9 ]
Location	Body (cg10116443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.50E+00	Statistic Test	p-value: 1.36E-02; Z-score: -8.33E-01
Methylation in Case	1.53E-01 (Median)	Methylation in Control	2.31E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A9 in atypical teratoid rhabdoid tumor			[ 9 ]
Location	3'UTR (cg02165693)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 1.53E-15; Z-score: -2.57E+00
Methylation in Case	6.26E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Colorectal cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A9 in colorectal cancer			[ 10 ]
Location	1stExon (cg01135800)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.15E-04; Z-score: -1.06E+00
Methylation in Case	8.43E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A9 in colorectal cancer			[ 10 ]
Location	Body (cg10116443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 2.09E-06; Z-score: -1.81E+00
Methylation in Case	8.78E-01 (Median)	Methylation in Control	9.11E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A9 in colorectal cancer			[ 10 ]
Location	3'UTR (cg02165693)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 5.99E-03; Z-score: -6.86E-02
Methylation in Case	9.42E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A9 in panic disorder			[ 11 ]
Location	Body (cg10116443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 1.28E-03; Z-score: -6.79E-01
Methylation in Case	1.18E+00 (Median)	Methylation in Control	1.45E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A9 in panic disorder			[ 11 ]
Location	3'UTR (cg02165693)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 4.32E-03; Z-score: -5.40E-01
Methylation in Case	1.48E+00 (Median)	Methylation in Control	1.76E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Anaplastic pilocytic astrocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC22A9 in anaplastic pilocytic astrocytoma than that in healthy individual
Studied Phenotype	Anaplastic pilocytic astrocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.90E-06; Fold-change: -0.2285826; Z-score: -1.139742458
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Chordoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC22A9 in chordoma than that in healthy individual
Studied Phenotype	Chordoma [ICD-11:5A61.0]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000108944; Fold-change: -0.28671078; Z-score: -2.258500655
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Hemangioblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC22A9 in hemangioblastoma than that in healthy individual
Studied Phenotype	Hemangioblastoma [ICD-11:2F7C]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 6.36E-05; Fold-change: -0.213070321; Z-score: -1.636582955
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Liver cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC22A9 in liver cancer than that in healthy individual
Studied Phenotype	Liver cancer [ICD-11:2C12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.001260366; Fold-change: -0.227053831; Z-score: -1.06784539
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
Oligodendroglial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC22A9 in oligodendroglial tumour than that in healthy individual
Studied Phenotype	Oligodendroglial tumour [ICD-11:2A00.Y1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 5.46E-09; Fold-change: -0.255845748; Z-score: -13.04980334
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Pituitary adenoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC22A9 in pituitary adenoma than that in healthy individual
Studied Phenotype	Pituitary adenoma [ICD-11:2F37]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 5.88E-09; Fold-change: -0.22616724; Z-score: -3.401922181
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Diffuse midline glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A9 in diffuse midline glioma than that in healthy individual
Studied Phenotype	Diffuse midline glioma [ICD-11:2A00.0Z]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 9.18E-42; Fold-change: -0.46204506; Z-score: -3.041330085
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Esthesioneuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A9 in esthesioneuroblastoma than that in healthy individual
Studied Phenotype	Esthesioneuroblastoma [ICD-11:2D50.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 4.05E-11; Fold-change: -0.450384702; Z-score: -2.503228524
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A9 in melanoma than that in healthy individual
Studied Phenotype	Melanoma [ICD-11:2C30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.53E-06; Fold-change: -0.431544866; Z-score: -1.933214434
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A9 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.23E-27; Fold-change: -0.663301577; Z-score: -4.041135438
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Peripheral neuroectodermal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC22A9 in peripheral neuroectodermal tumour than that in healthy individual
Studied Phenotype	Peripheral neuroectodermal tumour [ICD-11:2B52]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 5.01E-06; Fold-change: -0.367731426; Z-score: -1.527559117
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-145 directly targets SLC22A9			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-145	miRNA Mature ID	miR-145-5p
miRNA Sequence	GUCCAGUUUUCCCAGGAAUCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-335 directly targets SLC22A9			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-3p
miRNA Sequence	UUUUUCAUUAUUGCUCCUGACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-3925 directly targets SLC22A9			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3925	miRNA Mature ID	miR-3925-3p
miRNA Sequence	ACUCCAGUUUUAGUUCUCUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-4277 directly targets SLC22A9			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4277	miRNA Mature ID	miR-4277
miRNA Sequence	GCAGUUCUGAGCACAGUACAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-5195 directly targets SLC22A9			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5195	miRNA Mature ID	miR-5195-3p
miRNA Sequence	AUCCAGUUCUCUGAGGGGGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-5584 directly targets SLC22A9			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5584	miRNA Mature ID	miR-5584-3p
miRNA Sequence	UAGUUCUUCCCUUUGCCCAAUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-6778 directly targets SLC22A9			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6778	miRNA Mature ID	miR-6778-3p
miRNA Sequence	UGCCUCCCUGACAUUCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-6791 directly targets SLC22A9			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6791	miRNA Mature ID	miR-6791-3p
miRNA Sequence	UGCCUCCUUGGUCUCCGGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-6829 directly targets SLC22A9			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6829	miRNA Mature ID	miR-6829-3p
miRNA Sequence	UGCCUCCUCCGUGGCCUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-6836 directly targets SLC22A9			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6836	miRNA Mature ID	miR-6836-3p
miRNA Sequence	AUGCCUCCCCCGGCCCCGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-6882 directly targets SLC22A9			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6882	miRNA Mature ID	miR-6882-3p
miRNA Sequence	UGCUGCCUCUCCUCUUGCCUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	DNA Methylation Dynamics in Urological Tumors.
2	Genome-wide Scan for Methylation Profiles in Breast Cancer
3	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
5	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
9	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
10	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
11	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence