Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0501 Transporter Info
Gene Name SLCO3A1
Transporter Name Organic anion transporting polypeptide 3A1
Gene ID
28232
UniProt ID
Q9UIG8
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO3A1 in hepatocellular carcinoma [ 1 ]

Location

 TSS1500 (cg18841298)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.43E+00 Statistic Test p-value: 7.84E-13; Z-score: -3.70E+00

Methylation in Case

 4.50E-01 (Median) Methylation in Control 6.45E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLCO3A1 in hepatocellular carcinoma [ 1 ]

Location

 3'UTR (cg15841533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.08E-03; Z-score: -3.08E-01

Methylation in Case

 7.61E-01 (Median) Methylation in Control 7.72E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO3A1 in prostate cancer [ 2 ]

Location

 Body (cg19604369)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 3.17E-02; Z-score: 1.63E+00

Methylation in Case

 9.39E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO3A1 in atypical teratoid rhabdoid tumor [ 3 ]

Location

 3'UTR (cg15841533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 6.63E-11; Z-score: -1.95E+00

Methylation in Case

 7.31E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO3A1 in bladder cancer [ 4 ]

Location

 3'UTR (cg15841533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.39E+00 Statistic Test p-value: 1.46E-06; Z-score: -5.84E+00

Methylation in Case

 5.50E-01 (Median) Methylation in Control 7.65E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO3A1 in breast cancer [ 5 ]

Location

 3'UTR (cg15841533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.73E-09; Z-score: -1.68E+00

Methylation in Case

 6.70E-01 (Median) Methylation in Control 7.42E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO3A1 in colorectal cancer [ 6 ]

Location

 3'UTR (cg15841533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.05E-05; Z-score: -1.40E+00

Methylation in Case

 8.62E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO3A1 in HIV infection [ 7 ]

Location

 3'UTR (cg15841533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 6.62E-04; Z-score: -9.74E-01

Methylation in Case

 8.05E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLCO3A1 in lung adenocarcinoma [ 8 ]

Location

 3'UTR (cg15841533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.09E-02; Z-score: -1.31E+00

Methylation in Case

 7.72E-01 (Median) Methylation in Control 8.05E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Prostate cancer metastasis

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLCO3A1 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

 Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.020323556; Fold-change: -0.350823086; Z-score: -19.45993038
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

          58 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7e directly targets SLCO3A1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 let-7e miRNA Mature ID let-7e-5p

miRNA Sequence

 UGAGGUAGGAGGUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-103a directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-103a miRNA Mature ID miR-103a-3p

miRNA Sequence

 AGCAGCAUUGUACAGGGCUAUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-107 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-107 miRNA Mature ID miR-107

miRNA Sequence

 AGCAGCAUUGUACAGGGCUAUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-1224 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1224 miRNA Mature ID miR-1224-3p

miRNA Sequence

 CCCCACCUCCUCUCUCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-1470 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1470 miRNA Mature ID miR-1470

miRNA Sequence

 GCCCUCCGCCCGUGCACCCCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-149 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-149 miRNA Mature ID miR-149-5p

miRNA Sequence

 UCUGGCUCCGUGUCUUCACUCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-15a directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-15a miRNA Mature ID miR-15a-5p

miRNA Sequence

 UAGCAGCACAUAAUGGUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-15b directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

 UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-16 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-181b directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-181b miRNA Mature ID miR-181b-3p

miRNA Sequence

 CUCACUGAACAAUGAAUGCAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-192 directly targets SLCO3A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

 CUGACCUAUGAAUUGACAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-195 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

 UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-1972 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1972 miRNA Mature ID miR-1972

miRNA Sequence

 UCAGGCCAGGCACAGUGGCUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-210 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-210 miRNA Mature ID miR-210-3p

miRNA Sequence

 CUGUGCGUGUGACAGCGGCUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-215 directly targets SLCO3A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

 AUGACCUAUGAAUUGACAGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-218-1 directly targets SLCO3A1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-218-1 miRNA Mature ID miR-218-1-3p

miRNA Sequence

 AUGGUUCCGUCAAGCACCAUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-3150b directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3150b miRNA Mature ID miR-3150b-3p

miRNA Sequence

 UGAGGAGAUCGUCGAGGUUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-330 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-330 miRNA Mature ID miR-330-3p

miRNA Sequence

 GCAAAGCACACGGCCUGCAGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-370 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-370 miRNA Mature ID miR-370-5p

miRNA Sequence

 CAGGUCACGUCUCUGCAGUUAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-371a directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-371a miRNA Mature ID miR-371a-5p

miRNA Sequence

 ACUCAAACUGUGGGGGCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-371b directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-371b miRNA Mature ID miR-371b-5p

miRNA Sequence

 ACUCAAAAGAUGGCGGCACUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-372 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-372 miRNA Mature ID miR-372-5p

miRNA Sequence

 CCUCAAAUGUGGAGCACUAUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-373 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-373 miRNA Mature ID miR-373-5p

miRNA Sequence

 ACUCAAAAUGGGGGCGCUUUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-374b directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-374b miRNA Mature ID miR-374b-3p

miRNA Sequence

 CUUAGCAGGUUGUAUUAUCAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-3907 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3907 miRNA Mature ID miR-3907

miRNA Sequence

 AGGUGCUCCAGGCUGGCUCACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-3919 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3919 miRNA Mature ID miR-3919

miRNA Sequence

 GCAGAGAACAAAGGACUCAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-3974 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3974 miRNA Mature ID miR-3974

miRNA Sequence

 AAAGGUCAUUGUAAGGUUAAUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-424 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-424 miRNA Mature ID miR-424-5p

miRNA Sequence

 CAGCAGCAAUUCAUGUUUUGAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-4264 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4264 miRNA Mature ID miR-4264

miRNA Sequence

 ACUCAGUCAUGGUCAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-4420 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4420 miRNA Mature ID miR-4420

miRNA Sequence

 GUCACUGAUGUCUGUAGCUGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-4635 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4635 miRNA Mature ID miR-4635

miRNA Sequence

 UCUUGAAGUCAGAACCCGCAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-4650 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4650 miRNA Mature ID miR-4650-5p

miRNA Sequence

 UCAGGCCUCUUUCUACCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-4689 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4689 miRNA Mature ID miR-4689

miRNA Sequence

 UUGAGGAGACAUGGUGGGGGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 34

 miR-4756 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4756 miRNA Mature ID miR-4756-3p

miRNA Sequence

 CCAGAGAUGGUUGCCUUCCUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-4768 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4768 miRNA Mature ID miR-4768-5p

miRNA Sequence

 AUUCUCUCUGGAUCCCAUGGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 36

 miR-4784 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4784 miRNA Mature ID miR-4784

miRNA Sequence

 UGAGGAGAUGCUGGGACUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 37

 miR-497 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-497 miRNA Mature ID miR-497-5p

miRNA Sequence

 CAGCAGCACACUGUGGUUUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 38

 miR-548ae directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548ae miRNA Mature ID miR-548ae-3p

miRNA Sequence

 CAAAAACUGCAAUUACUUUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-548ah directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548ah miRNA Mature ID miR-548ah-3p

miRNA Sequence

 CAAAAACUGCAGUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 40

 miR-548aj directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548aj miRNA Mature ID miR-548aj-3p

miRNA Sequence

 UAAAAACUGCAAUUACUUUUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 41

 miR-548am directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548am miRNA Mature ID miR-548am-3p

miRNA Sequence

 CAAAAACUGCAGUUACUUUUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 42

 miR-548aq directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548aq miRNA Mature ID miR-548aq-3p

miRNA Sequence

 CAAAAACUGCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 43

 miR-548j directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548j miRNA Mature ID miR-548j-3p

miRNA Sequence

 CAAAAACUGCAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 44

 miR-548x directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548x miRNA Mature ID miR-548x-3p

miRNA Sequence

 UAAAAACUGCAAUUACUUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 45

 miR-5582 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5582 miRNA Mature ID miR-5582-3p

miRNA Sequence

 UAAAACUUUAAGUGUGCCUAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 46

 miR-616 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-616 miRNA Mature ID miR-616-5p

miRNA Sequence

 ACUCAAAACCCUUCAGUGACUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 47

 miR-622 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-622 miRNA Mature ID miR-622

miRNA Sequence

 ACAGUCUGCUGAGGUUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 48

 miR-6758 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6758 miRNA Mature ID miR-6758-5p

miRNA Sequence

 UAGAGAGGGGAAGGAUGUGAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 49

 miR-6765 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6765 miRNA Mature ID miR-6765-3p

miRNA Sequence

 UCACCUGGCUGGCCCGCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 50

 miR-6809 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6809 miRNA Mature ID miR-6809-3p

miRNA Sequence

 CUUCUCUUCUCUCCUUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 51

 miR-6833 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6833 miRNA Mature ID miR-6833-3p

miRNA Sequence

 UUUCUCUCUCCACUUCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 52

 miR-6838 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6838 miRNA Mature ID miR-6838-5p

miRNA Sequence

 AAGCAGCAGUGGCAAGACUCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 53

 miR-6856 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6856 miRNA Mature ID miR-6856-5p

miRNA Sequence

 AAGAGAGGAGCAGUGGUGCUGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 54

 miR-6858 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6858 miRNA Mature ID miR-6858-5p

miRNA Sequence

 GUGAGGAGGGGCUGGCAGGGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 55

 miR-6873 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6873 miRNA Mature ID miR-6873-3p

miRNA Sequence

 UUCUCUCUGUCUUUCUCUCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 56

 miR-6887 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6887 miRNA Mature ID miR-6887-3p

miRNA Sequence

 UCCCCUCCACUUUCCUCCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 57

 miR-874 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-874 miRNA Mature ID miR-874-5p

miRNA Sequence

 CGGCCCCACGCACCAGGGUAAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 58

 miR-933 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-933 miRNA Mature ID miR-933

miRNA Sequence

 UGUGCGCAGGGAGACCUCUCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
3 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
4 DNA Methylation Dynamics in Urological Tumors.
5 Genome-wide Scan for Methylation Profiles in Breast Cancer
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
10 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
11 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
12 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.